View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16541_low_15 (Length: 213)
Name: NF16541_low_15
Description: NF16541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16541_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 22 - 175
Target Start/End: Original strand, 3185846 - 3185999
Alignment:
| Q |
22 |
atgtatatataaatatgcaaggagatggaaataaagtaaggttgaagttaagtaacaaaaaataataattttatgatgatgttctcaattggcttttagc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3185846 |
atgtatatataaatatgcaaggagatggaaataaagtaaggttgaagttaagtaacaaaaaataataattttatgacgatgttctcaattggcttttagc |
3185945 |
T |
 |
| Q |
122 |
tctagtttataataaaattagttagcatataactaatttgtggttaaatgttaa |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3185946 |
tctagtttataataaaattagttagcatataactaatttgtggttaaatgttaa |
3185999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University