View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16541_low_3 (Length: 466)
Name: NF16541_low_3
Description: NF16541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16541_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 424; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 424; E-Value: 0
Query Start/End: Original strand, 18 - 457
Target Start/End: Complemental strand, 47054096 - 47053657
Alignment:
| Q |
18 |
atgaaaaccattccctcctaattactttccaatgcttcaaggttaaaatttttagtgttgatcatgtgccatgactatgtccctataaagtagaaataaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47054096 |
atgaaaaccattccctcctaattactttccaatgcttcaaggttaaaaattttagtgttgatcatgtgccatgactatgtccctataaagtagaaataat |
47053997 |
T |
 |
| Q |
118 |
ctatttaggaactttactatgatgcctctaccttggacaaatggaaaagatgaaacctgttggtgcttttgtgagtcggtcattgcatgtcagctagcgc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47053996 |
ctatttaggaactttactatgatgcctctaccttggacaaatggaaaagatgaaacctgttggtgcttttgtgagtcggtcattgcgtgtcagctagcgc |
47053897 |
T |
 |
| Q |
218 |
tgccacaagcattttgtagactgatgaagctgccaatgtttggagaaagcttagtgattgtttctcagaagataacattggttagaaacttagaatttca |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47053896 |
tgccacaagcattttgtagactgatgaagctgccaatgtttggagaaagcttagtgattgtttctcagaagataacattggttagaaacttagaatttca |
47053797 |
T |
 |
| Q |
318 |
taactcagcgtcgtctaagttccctaagctctattagggtttagtttcttcttagagaagagtgtgtgctcttccagcttggctcgtgtgtctctttgcc |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47053796 |
taactcagcgtcgtctaagttccctaagctctgttagggtttagtttcttcttagagaagagtgtgtgctcttccagcttggctcgtgtgtctctttgcc |
47053697 |
T |
 |
| Q |
418 |
tttgctccctttctctctttgtttcagttgtgattttgtt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47053696 |
tttgctccctttctctctttgtttcagttgtgattttgtt |
47053657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University