View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16541_low_9 (Length: 306)
Name: NF16541_low_9
Description: NF16541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16541_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 16 - 298
Target Start/End: Original strand, 45220315 - 45220597
Alignment:
| Q |
16 |
atatgtgctagaccaagtggccaactgattgcaatgtatcagataaagttttccactcaattccctgcgctcattcagccacgattgcaccatcattctt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45220315 |
atatgtgctagaccaagtggccaactgattgcaatgtatcagataaagttttccactcaattccctgcgctcattcagccacgattgcaccatcattctt |
45220414 |
T |
 |
| Q |
116 |
taatttcatattatcacctttatttaaagagaaattaacatgatttcttttctcaagtactttggaactgtaatcttgttagttctgtttgagatgaaat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45220415 |
taatttcatattatcacctttatttaaagagaaattaacatgatttcttttctcaagtactttggaactgtaatcttgttagttctgtttgagatgaaat |
45220514 |
T |
 |
| Q |
216 |
tgtaatttatgtacaattgaacttgttctaattttcctaactaaacttcacaaataacgaaattattaggttcaatatcctct |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
45220515 |
tgtaatttatgtacaattgaacttgttctaattttcctaactaaacttcacaaataacaaaattattaggttgaatatcctct |
45220597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University