View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16542_high_6 (Length: 220)
Name: NF16542_high_6
Description: NF16542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16542_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 16 - 204
Target Start/End: Complemental strand, 293393 - 293205
Alignment:
| Q |
16 |
caatcctatggcaggtttattttatataccctaattatgtcgtgaaaatatgattatttcatatattgcattggaagtgctaaagttgtgttatgtaatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
293393 |
caatcctatggcaggtttattttatataccctaattatgtcgtgaaaatatgattatttcatatattgcattggaagtgctaaagttgtgttatgtaatt |
293294 |
T |
|
| Q |
116 |
atcgttgcagttaaacagccctgatctgtttgatacttattcggctgggattgtactccttcaaatggcaataccaaccttaaggtctc |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
293293 |
atcgttgcagttaaacagccctgatctgtttgatacttattcggctgggattgtactccttcaaatggcaataccaaccttaaggtctc |
293205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 9e-20; HSPs: 7)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 119 - 204
Target Start/End: Original strand, 27493424 - 27493509
Alignment:
| Q |
119 |
gttgcagttaaacagccctgatctgtttgatacttattcggctgggattgtactccttcaaatggcaataccaaccttaaggtctc |
204 |
Q |
| |
|
||||||||||||||| |||||||| ||||||| ||||| ||||| ||||||||| | ||||| |||||||||||||||||||||| |
|
|
| T |
27493424 |
gttgcagttaaacagtcctgatctctttgatatgtattctgctggaattgtactcttgcaaattgcaataccaaccttaaggtctc |
27493509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 119 - 204
Target Start/End: Original strand, 27500082 - 27500167
Alignment:
| Q |
119 |
gttgcagttaaacagccctgatctgtttgatacttattcggctgggattgtactccttcaaatggcaataccaaccttaaggtctc |
204 |
Q |
| |
|
||||||||||||||| |||||||| ||||||| ||||| ||||| ||||||||| | ||||| |||||||||||||||||||||| |
|
|
| T |
27500082 |
gttgcagttaaacagtcctgatctctttgatatgtattctgctggaattgtactcttgcaaattgcaataccaaccttaaggtctc |
27500167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 119 - 204
Target Start/End: Original strand, 27514874 - 27514959
Alignment:
| Q |
119 |
gttgcagttaaacagccctgatctgtttgatacttattcggctgggattgtactccttcaaatggcaataccaaccttaaggtctc |
204 |
Q |
| |
|
||||||||||||||| |||||||| ||||||| ||||| ||||| ||||||||| | ||||| |||||||||||||||||||||| |
|
|
| T |
27514874 |
gttgcagttaaacagtcctgatctctttgatatgtattctgctggaattgtactcttgcaaattgcaataccaaccttaaggtctc |
27514959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 160 - 204
Target Start/End: Original strand, 27517486 - 27517530
Alignment:
| Q |
160 |
ctgggattgtactccttcaaatggcaataccaaccttaaggtctc |
204 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
27517486 |
ctgggattgttctccttcaaatggcaatgccaaccttaaggtctc |
27517530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 199
Target Start/End: Original strand, 27508515 - 27508549
Alignment:
| Q |
165 |
attgtactccttcaaatggcaataccaaccttaag |
199 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27508515 |
attgtgctccttcaaatggcaataccaaccttaag |
27508549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 204
Target Start/End: Original strand, 27496007 - 27496051
Alignment:
| Q |
160 |
ctgggattgtactccttcaaatggcaataccaaccttaaggtctc |
204 |
Q |
| |
|
|||| ||||| ||||||| |||||||||||||||||| ||||||| |
|
|
| T |
27496007 |
ctggaattgtgctccttccaatggcaataccaaccttgaggtctc |
27496051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 204
Target Start/End: Original strand, 27502665 - 27502709
Alignment:
| Q |
160 |
ctgggattgtactccttcaaatggcaataccaaccttaaggtctc |
204 |
Q |
| |
|
|||| ||||| ||||||| |||||||||||||||||| ||||||| |
|
|
| T |
27502665 |
ctggaattgtgctccttccaatggcaataccaaccttgaggtctc |
27502709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University