View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16542_low_6 (Length: 274)
Name: NF16542_low_6
Description: NF16542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16542_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 2 - 203
Target Start/End: Original strand, 4094205 - 4094409
Alignment:
| Q |
2 |
aaaccttcaataccggaatgaaagattccaaagccaaagagataaagataattattgattggagtaagatcatatacattgagatacaccatagcacgag |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4094205 |
aaaccttcaataccggaatgaaagattccaaagccaaagagataaagataattattgattggagtaagatcatatacattgagatacaccatagcacgag |
4094304 |
T |
 |
| Q |
102 |
aagcattctgagtgttccggtggtccctttcggagcttgtactcaattgaaaccaccgcattgtccaattatgaatcaaagtttcat---ttatgttatg |
198 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
4094305 |
aagtattctgagtgttccggtggtccctttcggagcttgtactcaattgaaaccaccgcattgtccaattatgaatcacagtttcattaattatgttatg |
4094404 |
T |
 |
| Q |
199 |
cagtg |
203 |
Q |
| |
|
||||| |
|
|
| T |
4094405 |
cagtg |
4094409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University