View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16543_high_35 (Length: 261)

Name: NF16543_high_35
Description: NF16543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16543_high_35
NF16543_high_35
[»] chr6 (1 HSPs)
chr6 (211-252)||(2553329-2553370)


Alignment Details
Target: chr6 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 211 - 252
Target Start/End: Original strand, 2553329 - 2553370
Alignment:
211 taggccaagtaatttatgactattatttttcccaccctatgc 252  Q
    ||||||||||||||||||||||||||||||||||||||||||    
2553329 taggccaagtaatttatgactattatttttcccaccctatgc 2553370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University