View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16543_high_37 (Length: 257)
Name: NF16543_high_37
Description: NF16543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16543_high_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 124 - 240
Target Start/End: Complemental strand, 6942492 - 6942378
Alignment:
| Q |
124 |
aaaacgccaagagagagttctaaattgaaattcataggagagttgatcgtattagtaaagtaccatggtgcgaagtcatccagcattgagcgaaactcca |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
6942492 |
aaaacgccaagagagagttctaaattgaaattcataggagagttgatcgtattagcaaagtaccatggtgcgaagtcgt--agcattgagcgaaactcca |
6942395 |
T |
 |
| Q |
224 |
gcaacatctcccgttca |
240 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
6942394 |
gcaacatctcccgttca |
6942378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University