View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16543_low_14 (Length: 455)
Name: NF16543_low_14
Description: NF16543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16543_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 415; Significance: 0; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 415; E-Value: 0
Query Start/End: Original strand, 16 - 450
Target Start/End: Complemental strand, 40113824 - 40113390
Alignment:
| Q |
16 |
gaagaaccttagaagatggatcttgtgtttcaacaaaggctctcacaagacggattttggttagttcagtttctgtgacaacatcatttgcaactacttg |
115 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40113824 |
gaagtaccttagaagatggatcttgtgtttcaacaaaggctctcacaagacggattttggttagttcagtttctgtgacaacatcatttgcaactacttg |
40113725 |
T |
 |
| Q |
116 |
tgcttttgcttctaattccttatgacaacccttcactgcttccattttcagttgacccttttcttcgcctttgtcctcttgatcaaagtgaagcttcttt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40113724 |
tgcttttgcttctaattccttatgacaacccttcactgcttccattttcagttgacccttttcttcgtctttgtcctcttgatcaaagtgaagcttcttt |
40113625 |
T |
 |
| Q |
216 |
tctagtactactatgtatgtattccagctcgatagtgcatatatatagaaagataattatgtttcaaatcaaatgcttgtaccgatgtaatgtgtgctga |
315 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40113624 |
tctagtactgctatgtatgtattccagctcgatagtacatatatatagaaagataattatgtttcaaatcaaatgcttgtaccgatgtaatgtgtgctga |
40113525 |
T |
 |
| Q |
316 |
actacctaatttgatactatctttcattttcagagccaactctgcagttaacgacaaatggtaaaaatgaactctatgcttattttgggatcgttctgtt |
415 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40113524 |
actacctaatttgatactatctttcattttcagagccaactctgcagttaacgacaaatggtaaaaatgaactctatgcttattttgggatcgttctgtt |
40113425 |
T |
 |
| Q |
416 |
ccgtctttgggctataaatattgaatacgattttt |
450 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
40113424 |
ccgtttttgggctataaatattgaatacgattttt |
40113390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 21 - 107
Target Start/End: Complemental strand, 40121080 - 40120994
Alignment:
| Q |
21 |
accttagaagatggatcttgtgtttcaacaaaggctctcacaagacggattttggttagttcagtttctgtgacaacatcatttgca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
40121080 |
accttagaagatggatcttgtgtttcaacaaagggtcgcacaagacggattttggttagttcagtttctgtaacagcatcatttgca |
40120994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University