View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16543_low_22 (Length: 349)
Name: NF16543_low_22
Description: NF16543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16543_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 9e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 4 - 213
Target Start/End: Original strand, 6942697 - 6942910
Alignment:
| Q |
4 |
cgtgagatatttgcattgaggatcgttattggtgttggac----acatcacaaattgtgtttgaacaaaatgttgttttagttatcaccaagtttgatgc |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6942697 |
cgtgagatatttgcattgaggatcgttattggtgttggacttggacatcacaaattgtgtttgaacaaaatgttgttttagttatcaccaagtttgatgc |
6942796 |
T |
 |
| Q |
100 |
atgcattgtacttccagaaaaatggatgagataatttatcaaactgagtattgcttcaaagattggttgcatcaagaatctatcaaaatggttgagagaa |
199 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
6942797 |
atgcattatacttccagaaaaatggatgagataatttatcgaactgagtattgcttcaaagattggttgcatccagaatctatcaaaatgattgagagaa |
6942896 |
T |
 |
| Q |
200 |
tttatcagatgctc |
213 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
6942897 |
tttatcagatgctc |
6942910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University