View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16543_low_26 (Length: 333)
Name: NF16543_low_26
Description: NF16543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16543_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 73 - 323
Target Start/End: Complemental strand, 47328905 - 47328652
Alignment:
| Q |
73 |
cttccttcattgagttcaccgggttgtagaggtaccaactcgattttaacttgatctttcacttaaatgtgagtattggcatgactgtc--ataaggcat |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
47328905 |
cttccttcattgagttcaccgggttgtagaggtaccaactcgattttaacttgatctttcacttaaatgtgagtattcgcatgactgtcgtataaggcat |
47328806 |
T |
 |
| Q |
171 |
ggagatcatattgccaaggtcttccnnnnnnnn-ggtggcaaacatccataagagtaacatcacaccaaactttgcgatcatagagatcatgtagctttt |
269 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
47328805 |
ggagatcatattgccaaggtcttacaaaaaaaaaggtggcaaacatccataagagtaacatcacaccaaactttgcgatcatagagatcatatagctttt |
47328706 |
T |
 |
| Q |
270 |
gtcgatggaaaagatacaagccaattttgagatactattactccattccctttg |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47328705 |
gtcgatggaaaagatacaagccaattttgagatactattactccattccctttg |
47328652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 7 - 51
Target Start/End: Complemental strand, 47328979 - 47328935
Alignment:
| Q |
7 |
cacatggcataaataactttgttgactataagttctaatgacttg |
51 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
47328979 |
cacatggcatatataactttgttgactataagttctagtgacttg |
47328935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University