View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16543_low_30 (Length: 317)
Name: NF16543_low_30
Description: NF16543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16543_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 19 - 302
Target Start/End: Complemental strand, 1435432 - 1435150
Alignment:
| Q |
19 |
caaataccaatgactcaatctcaattctcataacaataacaaacccactttcaccatctcattcaattttcttacaatggaagattcaaatccaaacaat |
118 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1435432 |
caaataccaatgactcaatctcacttctcataacaataacaaaccca-tttcaacatctcattcaattttcttacaatggaagattcaaatcccaacaat |
1435334 |
T |
 |
| Q |
119 |
tcacttcagaaacttcattgttctgttaagaattacgattggggtttacctggtcaattgtcacaggttgctaagctttctgagcttaattctgggttta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1435333 |
tcacttcagaaacttcattgttctgttaagaattacgattggggtttacctggtcaattgtcacaggttgctaagctttctgagcttaattctgggttta |
1435234 |
T |
 |
| Q |
219 |
aatttgatccaatgaagccttatgctgaactttggattggtacccatgattctggtccttcttttcttgtttctgatgatgatg |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1435233 |
aatttgatccaatgaagccttatgctgaactttggattggtacccatgattctggtccttcttttcttgtttctgatgatgatg |
1435150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University