View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16543_low_36 (Length: 297)
Name: NF16543_low_36
Description: NF16543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16543_low_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 125 - 281
Target Start/End: Original strand, 2023731 - 2023887
Alignment:
| Q |
125 |
gaggaaccttacaacaacatatgatctgtcacaaagtatatcaattgattcagacttatttttcataccaacttcaccctattttttcgattaaaaccaa |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2023731 |
gaggaaccttacaacaacatatgatctgtcacaaagtatatcaattgattcagacttatttttcataccaacttcaccctattttttcgattaaaaccaa |
2023830 |
T |
|
| Q |
225 |
gttgatttgcaaacaaacatctcagctcctttgcaatagtaaacaccatacactaac |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2023831 |
gttgatttgcaaacaaacatctcagctcctttgcaatagtaaacaccatacactaac |
2023887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 57 - 128
Target Start/End: Original strand, 2023614 - 2023685
Alignment:
| Q |
57 |
atttaataggcgagacaatgttaatagaaacttcattacaataaatttagaaactttgtttatggagtgagg |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2023614 |
atttaataggcgagacaatgttaatagaaacttcattacaataaatttagaaactttgtttattgagtgagg |
2023685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University