View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16543_low_47 (Length: 240)
Name: NF16543_low_47
Description: NF16543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16543_low_47 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 46 - 224
Target Start/End: Complemental strand, 4233675 - 4233490
Alignment:
| Q |
46 |
ttcaaatatgcatatatacctgtcgaggatcttttatttcttcgaaatcttgttcatcatcatcggtatcgggtatactttcaccggacctgatatcctc |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4233675 |
ttcaaatatgcatatatacctgtcgaggatcttttatttcttcaaaatcttgttcatcatcatcggtatcgggtataatttcaccggacctgatatcctc |
4233576 |
T |
|
| Q |
146 |
ctcgtgcattaccttagcgtaagattctctggttggttttctttagctcttca-------cctccgtaaccaccccgtcctccctg |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4233575 |
ctcgtgcattaccttagcgtaagattctctggttggttttctttagctcttcacgatcctcctccgtaaccaccccgtcctccctg |
4233490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 53 - 153
Target Start/End: Original strand, 36514220 - 36514320
Alignment:
| Q |
53 |
atgcatatatacctgtcgaggatcttttatttcttcgaaatcttgttcatcatcatcggtatcgggtatactttcaccggacctgatatcctcctcgtgc |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36514220 |
atgcatatatacctgtcgaggatcttttatttcttgaaaatcttgttcatcatcatcggaatcgggtatactttcattggacctgatatcctcctcgtgc |
36514319 |
T |
|
| Q |
153 |
a |
153 |
Q |
| |
|
| |
|
|
| T |
36514320 |
a |
36514320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University