View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16544_high_8 (Length: 283)
Name: NF16544_high_8
Description: NF16544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16544_high_8 |
 |  |
|
| [»] chr3 (14 HSPs) |
 |  |
|
| [»] scaffold0983 (1 HSPs) |
 |  |  |
|
| [»] scaffold0312 (1 HSPs) |
 |  |
|
| [»] scaffold1149 (1 HSPs) |
 |  |  |
|
| [»] scaffold1127 (1 HSPs) |
 |  |
|
| [»] scaffold1120 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 90; Significance: 2e-43; HSPs: 22)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 19 - 112
Target Start/End: Original strand, 15407228 - 15407321
Alignment:
| Q |
19 |
gatgatccattatttttgacatgtaatcccactcatataaacggtatgaaaggcaaattagagagtttttattggttgtcatgtaaaagatact |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15407228 |
gatgatccattatttttgacatgtaatcccactcatataaacggtatgaaagacaaattagagagtttttattggttgtcatgtaaaagatact |
15407321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 112 - 208
Target Start/End: Original strand, 15407399 - 15407495
Alignment:
| Q |
112 |
tcgaatccacaattcatcacttctcaacacttaggtatgtgagtttaccacatactaacgatgcacaatttaataagcagttaagtgataatacaag |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15407399 |
tcgaatccacaattcatcacttctcaacacttaggtatgtgagttcaccacatactaacgatgcacaatttaataagtagttaagtgataatacaag |
15407495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 233 - 281
Target Start/End: Complemental strand, 21497737 - 21497689
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgttc |
281 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
21497737 |
tggtggccgaggtttaaacctcgaaccttgcatatattatgcattgttc |
21497689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 232 - 279
Target Start/End: Original strand, 41542973 - 41543020
Alignment:
| Q |
232 |
atggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
41542973 |
atggtggccgaggtttaaaccccgaaccttacatatattatgcattgt |
41543020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 233 - 281
Target Start/End: Original strand, 32957534 - 32957582
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgttc |
281 |
Q |
| |
|
|||||||||||||||||||||| | |||| ||||||||||||||||||| |
|
|
| T |
32957534 |
tggtggccgaggtttaaaccccaaaccttacatatattatgcattgttc |
32957582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 233 - 279
Target Start/End: Complemental strand, 30243320 - 30243274
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||||||||| |||||||| ||||| |||||||||||||||| |
|
|
| T |
30243320 |
tggtggccgaggtttgaaccccgaaccttgtatatattatgcattgt |
30243274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 232 - 279
Target Start/End: Complemental strand, 30089120 - 30089073
Alignment:
| Q |
232 |
atggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
|||||||||||||||| ||||||| ||||| |||||||||||||||| |
|
|
| T |
30089120 |
atggtggccgaggtttgaaccccggaccttgtatatattatgcattgt |
30089073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 232 - 279
Target Start/End: Complemental strand, 30125724 - 30125677
Alignment:
| Q |
232 |
atggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
|||||||||||||||| ||||||| ||||| |||||||||||||||| |
|
|
| T |
30125724 |
atggtggccgaggtttgaaccccggaccttgtatatattatgcattgt |
30125677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 232 - 279
Target Start/End: Complemental strand, 34977275 - 34977228
Alignment:
| Q |
232 |
atggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
|||||||||| ||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
34977275 |
atggtggccggggtttaaactccggaccttgcatatattatgcattgt |
34977228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 236 - 279
Target Start/End: Complemental strand, 44694755 - 44694712
Alignment:
| Q |
236 |
tggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
|||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
44694755 |
tggccggggtttgaaccccgagccttgcatatattatgcattgt |
44694712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Complemental strand, 29544697 - 29544651
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||| ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
29544697 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
29544651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Original strand, 35820292 - 35820338
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||||||||| ||||||| |||||||| ||||||||||||| |
|
|
| T |
35820292 |
tggtggccgaggtttgaaccccggaccttgcatgtattatgcattgt |
35820338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Complemental strand, 36359384 - 36359338
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
|||||||| |||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
36359384 |
tggtggccaaggtttgaaccccggaccttgcatatattatgcattgt |
36359338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Complemental strand, 42066782 - 42066736
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||| |||||||| |
|
|
| T |
42066782 |
tggtggccgaggttcaaaccccggaccttgcatatattgtgcattgt |
42066736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 243 - 280
Target Start/End: Complemental strand, 40895915 - 40895878
Alignment:
| Q |
243 |
ggtttaaaccccgatccttgcatatattatgcattgtt |
280 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
40895915 |
ggtttaaaccccgaaccttccatatattatgcattgtt |
40895878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 243 - 279
Target Start/End: Complemental strand, 4833298 - 4833262
Alignment:
| Q |
243 |
ggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
4833298 |
ggtttgaaccccgatccttgcatattttatgcattgt |
4833262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 249 - 281
Target Start/End: Complemental strand, 13196754 - 13196722
Alignment:
| Q |
249 |
aaccccgatccttgcatatattatgcattgttc |
281 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
13196754 |
aaccccgaaccttgcatatattatgcattgttc |
13196722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 233 - 281
Target Start/End: Complemental strand, 19967488 - 19967440
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgttc |
281 |
Q |
| |
|
|||||| |||||||| ||| |||| ||||||| |||||||||||||||| |
|
|
| T |
19967488 |
tggtggtcgaggtttgaactccgaaccttgcacatattatgcattgttc |
19967440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 233 - 281
Target Start/End: Complemental strand, 20200775 - 20200727
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgttc |
281 |
Q |
| |
|
||||||||| ||||| ||||| | |||||||||||||||||||||||| |
|
|
| T |
20200775 |
tggtggccggggtttgaaccctggaccttgcatatattatgcattgttc |
20200727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 233 - 277
Target Start/End: Complemental strand, 27848228 - 27848184
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcatt |
277 |
Q |
| |
|
||||||||| ||||| ||||||| |||||||||||||||||||| |
|
|
| T |
27848228 |
tggtggccggggtttgaaccccggaccttgcatatattatgcatt |
27848184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 233 - 277
Target Start/End: Original strand, 42108119 - 42108163
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcatt |
277 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||| |||| |
|
|
| T |
42108119 |
tggtggccgaggtttaaaccccgaatcttgcatattttatacatt |
42108163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 235 - 279
Target Start/End: Complemental strand, 42791363 - 42791319
Alignment:
| Q |
235 |
gtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||| ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
42791363 |
gtggccggggtttgaaccccggaccttgcatatattatgcattgt |
42791319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 16)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 232 - 279
Target Start/End: Original strand, 8717465 - 8717512
Alignment:
| Q |
232 |
atggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
8717465 |
atggtggccgaggtttgaaccccgaaccttgcatatattatgcattgt |
8717512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 233 - 279
Target Start/End: Complemental strand, 444483 - 444437
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
444483 |
tggtggccggggtttaaaccccggaccttgcatatattatgcattgt |
444437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 233 - 283
Target Start/End: Complemental strand, 6471581 - 6471531
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgttcct |
283 |
Q |
| |
|
||||||||| ||||| |||||||| | |||||||||||||||||||||||| |
|
|
| T |
6471581 |
tggtggccggggtttgaaccccgaacattgcatatattatgcattgttcct |
6471531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 243 - 281
Target Start/End: Original strand, 29924918 - 29924956
Alignment:
| Q |
243 |
ggtttaaaccccgatccttgcatatattatgcattgttc |
281 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29924918 |
ggtttaaaccccgaaccttgcatatattatgcattgttc |
29924956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 233 - 281
Target Start/End: Original strand, 44084263 - 44084310
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgttc |
281 |
Q |
| |
|
||||||||||||||| ||||| || |||||||||||||||||||||||| |
|
|
| T |
44084263 |
tggtggccgaggtttgaacccgga-ccttgcatatattatgcattgttc |
44084310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Complemental strand, 5179863 - 5179817
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
|||||||||| |||| |||||||| ||||| |||||||||||||||| |
|
|
| T |
5179863 |
tggtggccgaagtttgaaccccgaaccttgtatatattatgcattgt |
5179817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Complemental strand, 12748971 - 12748925
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||| ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
12748971 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
12748925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Original strand, 13357432 - 13357478
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||||||||| |||| || |||||||||||||||||||||| |
|
|
| T |
13357432 |
tggtggccgaggtttgaacctcgtaccttgcatatattatgcattgt |
13357478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Original strand, 32051523 - 32051569
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||| ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
32051523 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
32051569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Complemental strand, 37141427 - 37141381
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||| |||| |||||||| |||||||||||||||||||||| |
|
|
| T |
37141427 |
tggtggccggagtttgaaccccgaaccttgcatatattatgcattgt |
37141381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 281
Target Start/End: Original strand, 30694441 - 30694478
Alignment:
| Q |
244 |
gtttaaaccccgatccttgcatatattatgcattgttc |
281 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
30694441 |
gtttaaaccccgaaccttgcatattttatgcattgttc |
30694478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 232 - 281
Target Start/End: Original strand, 37749989 - 37750038
Alignment:
| Q |
232 |
atggtggccgaggtttaaaccccgatccttgcatatattatgcattgttc |
281 |
Q |
| |
|
|||||||||| |||| |||||||| | |||||||||||||||||||||| |
|
|
| T |
37749989 |
atggtggccggggttcaaaccccggactttgcatatattatgcattgttc |
37750038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 236 - 281
Target Start/End: Original strand, 44037359 - 44037404
Alignment:
| Q |
236 |
tggccgaggtttaaaccccgatccttgcatatattatgcattgttc |
281 |
Q |
| |
|
|||||||||||||||| |||| |||| |||||||||||||||||| |
|
|
| T |
44037359 |
tggccgaggtttaaacaccgaatcttgtatatattatgcattgttc |
44037404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 234 - 279
Target Start/End: Complemental strand, 44794962 - 44794917
Alignment:
| Q |
234 |
ggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
|||||||||||||| ||| ||| |||||||||||||||||||||| |
|
|
| T |
44794962 |
ggtggccgaggtttgaactccggaccttgcatatattatgcattgt |
44794917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 233 - 277
Target Start/End: Complemental strand, 3650590 - 3650546
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcatt |
277 |
Q |
| |
|
||||||||| ||||| |||||||| |||| ||||||||||||||| |
|
|
| T |
3650590 |
tggtggccggggtttgaaccccgaaccttacatatattatgcatt |
3650546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 233 - 281
Target Start/End: Original strand, 26196595 - 26196643
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgttc |
281 |
Q |
| |
|
||||||||| |||| |||| ||| |||||||||||||||||||||||| |
|
|
| T |
26196595 |
tggtggccggagtttgaaccacgaaccttgcatatattatgcattgttc |
26196643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000006; HSPs: 13)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 233 - 281
Target Start/End: Complemental strand, 28951469 - 28951421
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgttc |
281 |
Q |
| |
|
||||||||||||||||||| | || |||||||||||||||||||||||| |
|
|
| T |
28951469 |
tggtggccgaggtttaaactctgaaccttgcatatattatgcattgttc |
28951421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 233 - 279
Target Start/End: Original strand, 8629687 - 8629733
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
|||||| |||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
8629687 |
tggtggtcgaggtttgaaccccgaaccttgcatatattatgcattgt |
8629733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 233 - 279
Target Start/End: Complemental strand, 33824951 - 33824905
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
33824951 |
tggtggccgaggtttgaaccccggaccttgcatatattatgcattgt |
33824905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 233 - 281
Target Start/End: Complemental strand, 21599027 - 21598979
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgttc |
281 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
21599027 |
tggtggccggggtttaaaccccgtaccttgcatatattatgtattgttc |
21598979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Original strand, 2617196 - 2617242
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
|||||||||||||||||||| | | |||| ||||||||||||||||| |
|
|
| T |
2617196 |
tggtggccgaggtttaaacctcaaaccttacatatattatgcattgt |
2617242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Complemental strand, 8569779 - 8569733
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||| ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
8569779 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
8569733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Complemental strand, 9333801 - 9333755
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||| ||||||||| |
|
|
| T |
9333801 |
tggtggccgagatttaaaccccggaccttgcatatataatgcattgt |
9333755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Complemental strand, 16390499 - 16390453
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||||||||| ||||||| |||| ||||||||||||||||| |
|
|
| T |
16390499 |
tggtggccgaggtttgaaccccggaccttacatatattatgcattgt |
16390453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 235 - 279
Target Start/End: Original strand, 331879 - 331923
Alignment:
| Q |
235 |
gtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||||||| || ||| | |||||||||||||||||||||| |
|
|
| T |
331879 |
gtggccgaggtttgaatcccaaaccttgcatatattatgcattgt |
331923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 243 - 283
Target Start/End: Complemental strand, 1535363 - 1535323
Alignment:
| Q |
243 |
ggtttaaaccccgatccttgcatatattatgcattgttcct |
283 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
1535363 |
ggtttaaacttcaatccttgcatatattatgcattgttcct |
1535323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 243 - 279
Target Start/End: Original strand, 12591028 - 12591064
Alignment:
| Q |
243 |
ggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
12591028 |
ggtttaaatcccgaaccttgcatatattatgcattgt |
12591064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 235 - 279
Target Start/End: Original strand, 26356074 - 26356118
Alignment:
| Q |
235 |
gtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||| |||| |||||||| |||||||||||||||||||||| |
|
|
| T |
26356074 |
gtggccggagtttgaaccccgaaccttgcatatattatgcattgt |
26356118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 233 - 281
Target Start/End: Complemental strand, 26548321 - 26548273
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgttc |
281 |
Q |
| |
|
||||||| | ||||| |||||||| ||||||||||||||| |||||||| |
|
|
| T |
26548321 |
tggtggctggggtttgaaccccgaaccttgcatatattatacattgttc |
26548273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 11)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 233 - 279
Target Start/End: Complemental strand, 7230350 - 7230304
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
7230350 |
tggtggccgaggtttgaaccccggaccttgcatatattatgcattgt |
7230304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 233 - 278
Target Start/End: Complemental strand, 34042310 - 34042265
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattg |
278 |
Q |
| |
|
|||||| |||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
34042310 |
tggtggtcgaggtttgaaccccgaaccttgcatatattatgcattg |
34042265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Original strand, 25101381 - 25101427
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||| |||| ||||||||| |||||||||| ||||||||||| |
|
|
| T |
25101381 |
tggtggccggggttcaaaccccgacccttgcatattttatgcattgt |
25101427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Complemental strand, 26033345 - 26033299
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||| ||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
26033345 |
tggtggctgaggtttaaaccctgaagcttgcatatattatgcattgt |
26033299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Original strand, 28435239 - 28435285
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||| | ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
28435239 |
tggtggctggggtttgaaccccgaaccttgcatatattatgcattgt |
28435285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Original strand, 49041972 - 49042018
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||| ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
49041972 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
49042018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 232 - 281
Target Start/End: Original strand, 19479467 - 19479516
Alignment:
| Q |
232 |
atggtggccgaggtttaaaccccgatccttgcatatattatgcattgttc |
281 |
Q |
| |
|
||||||| || ||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
19479467 |
atggtggtcggggtttgaaccccggaccttgcatatattatgcattgttc |
19479516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 233 - 281
Target Start/End: Complemental strand, 3936697 - 3936649
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgttc |
281 |
Q |
| |
|
||||||||| |||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
3936697 |
tggtggccggggttcgaaccccggaccttgcatatattatgcattgttc |
3936649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 235 - 279
Target Start/End: Complemental strand, 10148247 - 10148203
Alignment:
| Q |
235 |
gtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||||||| ||| | || |||||||||||||||||||||| |
|
|
| T |
10148247 |
gtggccgaggtttgaactctgaaccttgcatatattatgcattgt |
10148203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 243 - 279
Target Start/End: Complemental strand, 22040710 - 22040674
Alignment:
| Q |
243 |
ggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
22040710 |
ggtttgaaccccgaaccttgcatatattatgcattgt |
22040674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 237 - 281
Target Start/End: Original strand, 50152233 - 50152277
Alignment:
| Q |
237 |
ggccgaggtttaaaccccgatccttgcatatattatgcattgttc |
281 |
Q |
| |
|
||||| ||||| |||||||| ||||||||||||||||||| |||| |
|
|
| T |
50152233 |
ggccggggtttgaaccccgaaccttgcatatattatgcatcgttc |
50152277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 14)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 233 - 283
Target Start/End: Original strand, 3176965 - 3177014
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgttcct |
283 |
Q |
| |
|
||||||||| ||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
3176965 |
tggtggccgtggtttaaacccaga-ccttgcatatattatgcattgttcct |
3177014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 233 - 279
Target Start/End: Complemental strand, 3755409 - 3755363
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
3755409 |
tggtggccgaggtttaaaccctggaccttgcatatattatgcattgt |
3755363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 235 - 279
Target Start/End: Original strand, 42886502 - 42886546
Alignment:
| Q |
235 |
gtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||||||| |||||||| |||||||||| ||||||||||| |
|
|
| T |
42886502 |
gtggccgaggtttgaaccccgaaccttgcatattttatgcattgt |
42886546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 232 - 279
Target Start/End: Complemental strand, 52119447 - 52119400
Alignment:
| Q |
232 |
atggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
|||||||||| |||| |||||||| |||||||||||||||||||||| |
|
|
| T |
52119447 |
atggtggccggggttcgaaccccgaaccttgcatatattatgcattgt |
52119400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Complemental strand, 10926539 - 10926493
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
|||||||||| ||| |||||||| |||||||||||||||||||||| |
|
|
| T |
10926539 |
tggtggccgacatttgaaccccgaaccttgcatatattatgcattgt |
10926493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 235 - 281
Target Start/End: Original strand, 20612270 - 20612316
Alignment:
| Q |
235 |
gtggccgaggtttaaaccccgatccttgcatatattatgcattgttc |
281 |
Q |
| |
|
||||||| ||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
20612270 |
gtggccggggtttgaaccccaaaccttgcatatattatgcattgttc |
20612316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Complemental strand, 29631256 - 29631210
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||| ||||| || ||||| |||||||||||||||||||||| |
|
|
| T |
29631256 |
tggtggccggggtttgaatcccgaaccttgcatatattatgcattgt |
29631210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Original strand, 38130950 - 38130996
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||| ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
38130950 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
38130996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Original strand, 48796209 - 48796255
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||| ||||| |||||||| |||||||||| ||||||||||| |
|
|
| T |
48796209 |
tggtggccggggtttgaaccccgaaccttgcatatcttatgcattgt |
48796255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Original strand, 48849754 - 48849800
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||| ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
48849754 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
48849800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 233 - 278
Target Start/End: Original strand, 913591 - 913636
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattg |
278 |
Q |
| |
|
||||||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
913591 |
tggtggcagaggtttgaaccccggaccttgcatatattatgcattg |
913636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 233 - 281
Target Start/End: Original strand, 28965768 - 28965816
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgttc |
281 |
Q |
| |
|
||||| ||| ||||| |||||||| |||| ||||||||||||||||||| |
|
|
| T |
28965768 |
tggtgaccggggtttgaaccccgaaccttacatatattatgcattgttc |
28965816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 243 - 279
Target Start/End: Complemental strand, 39779084 - 39779048
Alignment:
| Q |
243 |
ggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
39779084 |
ggtttgaaccccgaaccttgcatatattatgcattgt |
39779048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 249 - 281
Target Start/End: Complemental strand, 45334243 - 45334211
Alignment:
| Q |
249 |
aaccccgatccttgcatatattatgcattgttc |
281 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
45334243 |
aaccccgaaccttgcatatattatgcattgttc |
45334211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 11)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 233 - 279
Target Start/End: Original strand, 34521181 - 34521227
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
34521181 |
tggtggccgaggtttgaaccccggaccttgcatatattatgcattgt |
34521227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 232 - 276
Target Start/End: Complemental strand, 8094112 - 8094068
Alignment:
| Q |
232 |
atggtggccgaggtttaaaccccgatccttgcatatattatgcat |
276 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
8094112 |
atggtggccggggtttaaaccccgcaccttgcatatattatgcat |
8094068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 233 - 277
Target Start/End: Complemental strand, 34595942 - 34595898
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcatt |
277 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
34595942 |
tggtggccgaggtttgaaccccggaccttgcatatattatgcatt |
34595898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 239 - 283
Target Start/End: Complemental strand, 47070912 - 47070868
Alignment:
| Q |
239 |
ccgaggtttaaaccccgatccttgcatatattatgcattgttcct |
283 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||| ||||||||| |
|
|
| T |
47070912 |
ccgaggtttaaactccgaaccttgcatatattatgtattgttcct |
47070868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 283
Target Start/End: Complemental strand, 422617 - 422567
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgttcct |
283 |
Q |
| |
|
|||||||||| |||||||| |||| |||| ||||||||||||||| ||||| |
|
|
| T |
422617 |
tggtggccgaagtttaaactccgaaccttacatatattatgcattattcct |
422567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Complemental strand, 7925433 - 7925388
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||||||||| |||||||| |||| ||||||||||||||||| |
|
|
| T |
7925433 |
tggtggccgaggtttgaaccccgaacctt-catatattatgcattgt |
7925388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 283
Target Start/End: Complemental strand, 11913800 - 11913750
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgttcct |
283 |
Q |
| |
|
||||| ||||||||| || ||||| ||||| |||||||||||||||||||| |
|
|
| T |
11913800 |
tggtgaccgaggtttgaatcccgaaccttgtatatattatgcattgttcct |
11913750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Complemental strand, 27533313 - 27533267
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
|||||| || ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
27533313 |
tggtggtcggggtttgaaccccgaaccttgcatatattatgcattgt |
27533267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Complemental strand, 47417853 - 47417807
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||| ||||||||| ||| |||| |||||||||||||||||||||| |
|
|
| T |
47417853 |
tggtgaccgaggtttgaactccgaaccttgcatatattatgcattgt |
47417807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 233 - 281
Target Start/End: Original strand, 4715549 - 4715597
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgttc |
281 |
Q |
| |
|
|||||||||||||| |||||| | |||||||||| ||||||||||||| |
|
|
| T |
4715549 |
tggtggccgaggttcgaaccccaaaccttgcatattttatgcattgttc |
4715597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 243 - 283
Target Start/End: Original strand, 12268985 - 12269025
Alignment:
| Q |
243 |
ggtttaaaccccgatccttgcatatattatgcattgttcct |
283 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
12268985 |
ggtttgaaccccggaccttgcatatattatgcattgttcct |
12269025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 10)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 232 - 277
Target Start/End: Original strand, 26529681 - 26529726
Alignment:
| Q |
232 |
atggtggccgaggtttaaaccccgatccttgcatatattatgcatt |
277 |
Q |
| |
|
||||||| || |||||||||||||| |||||||||||||||||||| |
|
|
| T |
26529681 |
atggtggtcggggtttaaaccccgaaccttgcatatattatgcatt |
26529726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 232 - 279
Target Start/End: Original strand, 48629055 - 48629102
Alignment:
| Q |
232 |
atggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||| || ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48629055 |
atggtggtcggggtttaaaccccggaccttgcatatattatgcattgt |
48629102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 235 - 281
Target Start/End: Complemental strand, 7670502 - 7670456
Alignment:
| Q |
235 |
gtggccgaggtttaaaccccgatccttgcatatattatgcattgttc |
281 |
Q |
| |
|
|||| |||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
7670502 |
gtggtcgaggtttgaaccccggaccttgcatatattatgcattgttc |
7670456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 235 - 277
Target Start/End: Original strand, 19988688 - 19988730
Alignment:
| Q |
235 |
gtggccgaggtttaaaccccgatccttgcatatattatgcatt |
277 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
19988688 |
gtggccgaggtttaaaccacggaccttgcatatattatgcatt |
19988730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Original strand, 27462427 - 27462473
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||| ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
27462427 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
27462473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 232 - 277
Target Start/End: Original strand, 2962716 - 2962761
Alignment:
| Q |
232 |
atggtggccgaggtttaaaccccgatccttgcatatattatgcatt |
277 |
Q |
| |
|
|||||||||| | || ||||||||| |||||||||||||||||||| |
|
|
| T |
2962716 |
atggtggccgggattcaaaccccgaaccttgcatatattatgcatt |
2962761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 232 - 281
Target Start/End: Complemental strand, 9522983 - 9522934
Alignment:
| Q |
232 |
atggtggccgaggtttaaaccccgatccttgcatatattatgcattgttc |
281 |
Q |
| |
|
|||||||||| |||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
9522983 |
atggtggccggggttcgaaccccaaaccttgcatatattatgcattgttc |
9522934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 232 - 281
Target Start/End: Complemental strand, 10327024 - 10326976
Alignment:
| Q |
232 |
atggtggccgaggtttaaaccccgatccttgcatatattatgcattgttc |
281 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
10327024 |
atggtggccgaggtttgaacctgga-ccttgcatatattatgcattgttc |
10326976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 232 - 276
Target Start/End: Original strand, 42095933 - 42095977
Alignment:
| Q |
232 |
atggtggccgaggtttaaaccccgatccttgcatatattatgcat |
276 |
Q |
| |
|
|||||||| ||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
42095933 |
atggtggcagaggtttgaaccccggaccttgcatatattatgcat |
42095977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 233 - 281
Target Start/End: Complemental strand, 45088945 - 45088898
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgttc |
281 |
Q |
| |
|
|||||| || ||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
45088945 |
tggtggtcggggtttgaaccccga-ccttgcatatattatgcattgttc |
45088898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 11)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 232 - 281
Target Start/End: Original strand, 12909156 - 12909205
Alignment:
| Q |
232 |
atggtggccgaggtttaaaccccgatccttgcatatattatgcattgttc |
281 |
Q |
| |
|
||||||||| |||||||||||| || |||| ||||||||||||||||||| |
|
|
| T |
12909156 |
atggtggccaaggtttaaaccctgaaccttacatatattatgcattgttc |
12909205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 235 - 282
Target Start/End: Complemental strand, 42473962 - 42473915
Alignment:
| Q |
235 |
gtggccgaggtttaaaccccgatccttgcatatattatgcattgttcc |
282 |
Q |
| |
|
||||||| ||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
42473962 |
gtggccgtggtttgaaccccggaccttgcatatattatgcattgttcc |
42473915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Complemental strand, 11720963 - 11720918
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
11720963 |
tggtggccggggtttgaaccccga-ccttgcatatattatgcattgt |
11720918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 243 - 281
Target Start/End: Original strand, 18589868 - 18589906
Alignment:
| Q |
243 |
ggtttaaaccccgatccttgcatatattatgcattgttc |
281 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18589868 |
ggtttaaaccccggaccttgcatatattatgcattgttc |
18589906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Original strand, 22522792 - 22522838
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||| ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
22522792 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
22522838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Complemental strand, 25979914 - 25979868
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
25979914 |
tggtggccgaggtttgaaccccggaccttgcatacattatgcattgt |
25979868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Original strand, 36736812 - 36736858
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||||||||| | |||||| ||||| |||||||||||||||| |
|
|
| T |
36736812 |
tggtggccgaggtttgagccccgaaccttgaatatattatgcattgt |
36736858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 279
Target Start/End: Original strand, 40715940 - 40715986
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||||||| ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
40715940 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
40715986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 232 - 277
Target Start/End: Original strand, 12670064 - 12670109
Alignment:
| Q |
232 |
atggtggccgaggtttaaaccccgatccttgcatatattatgcatt |
277 |
Q |
| |
|
||||||| | |||||| |||||||| |||||||||||||||||||| |
|
|
| T |
12670064 |
atggtggtcaaggtttgaaccccgaaccttgcatatattatgcatt |
12670109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 281
Target Start/End: Complemental strand, 27903172 - 27903135
Alignment:
| Q |
244 |
gtttaaaccccgatccttgcatatattatgcattgttc |
281 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
27903172 |
gtttgaaccccgaaccttgcatatattatgcattgttc |
27903135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 233 - 281
Target Start/End: Complemental strand, 6894166 - 6894118
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgttc |
281 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| || |||||||||| |
|
|
| T |
6894166 |
tggtggccgaggttcgaaccccgaaccttgcatattttttgcattgttc |
6894118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0983 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0983
Description:
Target: scaffold0983; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 235 - 273
Target Start/End: Original strand, 3308 - 3346
Alignment:
| Q |
235 |
gtggccgaggtttaaaccccgatccttgcatatattatg |
273 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
3308 |
gtggccgaggtttgaaccccgaaccttgcatatattatg |
3346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0312 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0312
Description:
Target: scaffold0312; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 233 - 283
Target Start/End: Original strand, 7955 - 8005
Alignment:
| Q |
233 |
tggtggccgaggtttaaaccccgatccttgcatatattatgcattgttcct |
283 |
Q |
| |
|
|||||||||| |||||||| |||| |||| ||||||||||||||| ||||| |
|
|
| T |
7955 |
tggtggccgaagtttaaactccgaaccttacatatattatgcattattcct |
8005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1149 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold1149
Description:
Target: scaffold1149; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 235 - 279
Target Start/End: Complemental strand, 2400 - 2356
Alignment:
| Q |
235 |
gtggccgaggtttaaaccccgatccttgcatatattatgcattgt |
279 |
Q |
| |
|
||||| ||||||| |||||| | |||||||||||||||||||||| |
|
|
| T |
2400 |
gtggctgaggtttgaaccccaaaccttgcatatattatgcattgt |
2356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1127 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold1127
Description:
Target: scaffold1127; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 243 - 283
Target Start/End: Original strand, 1166 - 1206
Alignment:
| Q |
243 |
ggtttaaaccccgatccttgcatatattatgcattgttcct |
283 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
1166 |
ggtttgaaccccggaccttgcatatattatgcattgttcct |
1206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1120 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold1120
Description:
Target: scaffold1120; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 243 - 283
Target Start/End: Complemental strand, 1973 - 1933
Alignment:
| Q |
243 |
ggtttaaaccccgatccttgcatatattatgcattgttcct |
283 |
Q |
| |
|
||||| |||| ||| |||||||||||||||||||||||||| |
|
|
| T |
1973 |
ggtttgaaccacgaaccttgcatatattatgcattgttcct |
1933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University