View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16544_low_17 (Length: 211)
Name: NF16544_low_17
Description: NF16544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16544_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 37150602 - 37150401
Alignment:
| Q |
1 |
tcgaaactctccttctctctgttgatccatatcttcgcggaacaatcaccggcacccttgaaggccttttcattccacaatatcaacttaatcaggtaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37150602 |
tcgaaactctccttctctctgttgatccatatcttcgcggaacaatcaccggcacccttgaaggccttttcattccacaatatcaacttaatcaggtaca |
37150503 |
T |
|
| Q |
101 |
tttattatgaattag---------ggttgagtctcactaaagccctacaaaatcgacttattatcttaagtcaaatattatcttatttaatgtgatactt |
191 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37150502 |
tttattatgaattagggttattagggttgagtctcactaaagccctacaaaatcgacttattatcttaagtcaaatattatcttatttaatgtgatactt |
37150403 |
T |
|
| Q |
192 |
tt |
193 |
Q |
| |
|
|| |
|
|
| T |
37150402 |
tt |
37150401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 3 - 108
Target Start/End: Complemental strand, 37161327 - 37161222
Alignment:
| Q |
3 |
gaaactctccttctctctgttgatccatatcttcgcggaacaatcaccggcacccttgaaggccttttcattccacaatatcaacttaatcaggtacatt |
102 |
Q |
| |
|
|||||||||||||| || ||||| || |||||||| |||| |||||| || ||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37161327 |
gaaactctccttctttccgttgacccttatcttcgtggaagaatcactggtacctcagaaggccttttcatttcacaatatcaacttaatcaggtacatt |
37161228 |
T |
|
| Q |
103 |
tattat |
108 |
Q |
| |
|
| |||| |
|
|
| T |
37161227 |
ttttat |
37161222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 37155728 - 37155628
Alignment:
| Q |
1 |
tcgaaactctccttctctctgttgatccatatcttcgcggaacaatcaccggcacccttgaaggccttttcattccacaatatcaacttaatcaggtaca |
100 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||| ||||||||||||||||| | || ||||||| || |||||| || | ||||||||||||| |
|
|
| T |
37155728 |
tcgaaactctccttctctccgttgatccttatcttcgcagaacaatcaccggcaccatcgatggcctttatatgccacaacatgagattaatcaggtaca |
37155629 |
T |
|
| Q |
101 |
t |
101 |
Q |
| |
|
| |
|
|
| T |
37155628 |
t |
37155628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University