View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16545_high_1 (Length: 352)

Name: NF16545_high_1
Description: NF16545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16545_high_1
NF16545_high_1
[»] chr8 (2 HSPs)
chr8 (10-149)||(38582922-38583061)
chr8 (214-352)||(38582721-38582860)


Alignment Details
Target: chr8 (Bit Score: 116; Significance: 6e-59; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 10 - 149
Target Start/End: Complemental strand, 38583061 - 38582922
Alignment:
10 aaatgaattattaggtgaaattaatcttgtagatgaacgctagttaccttatctacccaaattcttttttaccatgaagcattttaaagcttcttgtatg 109  Q
    |||||||| ||| |||||||  || ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38583061 aaatgaatcattgggtgaaacgaaccttgtagattaacgctagttaccttatctacccaaattcttttttaccatgaagcattttaaagcttcttgtatg 38582962  T
110 tgaaattgacttcaaatattcccagatgatgaaagtagtc 149  Q
    ||||||||||||||||||||||||||||||||||||||||    
38582961 tgaaattgacttcaaatattcccagatgatgaaagtagtc 38582922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 214 - 352
Target Start/End: Complemental strand, 38582860 - 38582721
Alignment:
214 catcttgatttttt-ctccgcaaggcaagcttttaaaattgattatggattttaannnnnnngaatggaacattgattgtagatgtagatatagagttgc 312  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||       |||||||||||||||| |||||||||||||| ||||||    
38582860 catcttgatttttttctccgcaaggcaagcttttaaaattgattatggattttaatttttttgaatggaacattgattatagatgtagatatatagttgc 38582761  T
313 actaacatatgagaatcagagatatcaaaaacttatgtct 352  Q
    ||||||||||||||||||||||||||||||||||||||||    
38582760 actaacatatgagaatcagagatatcaaaaacttatgtct 38582721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University