View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16545_low_14 (Length: 236)
Name: NF16545_low_14
Description: NF16545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16545_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 16 - 220
Target Start/End: Original strand, 37245696 - 37245900
Alignment:
| Q |
16 |
tacttctacgggtgccaacaacggcactactttgacagacccttcacagagtactacctcatagtaatatgtttattctagtgatggacctaattctgtt |
115 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37245696 |
tacttctacgagtgccaacaacagcactactttgacagacccttcacagagtactacctcatagtactatgtttattctagtgatggacctaattctgtt |
37245795 |
T |
 |
| Q |
116 |
acggttacacctctcttggatggaagcaacaaccttgcttgggctcaagcaatgcgttgtgctttaggttctaagaacaagtttaagttcgttgatggaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37245796 |
acggttacacctctcttggatggaagcaacaaccttgcttgggctcaagcaatgcgttgtgctttaggttctaagaacaagtttaagttcgttgatggaa |
37245895 |
T |
 |
| Q |
216 |
gcatt |
220 |
Q |
| |
|
||||| |
|
|
| T |
37245896 |
gcatt |
37245900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 55; Significance: 1e-22; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 98 - 220
Target Start/End: Original strand, 4261067 - 4261189
Alignment:
| Q |
98 |
gatggacctaattctgttacggttacacctctcttggatggaagcaacaaccttgcttgggctcaagcaatgcgttgtgctttaggttctaagaacaagt |
197 |
Q |
| |
|
||||||||||||| |||| ||||||||| || |||||||||| ||| ||||||||||||| ||| || ||| |||||||||| |||||||||||| |
|
|
| T |
4261067 |
gatggacctaattatgtttcggttacactgcttttggatggaaaaaactttcttgcttgggctcgagcgattcgtcatgctttaggtgctaagaacaagt |
4261166 |
T |
 |
| Q |
198 |
ttaagttcgttgatggaagcatt |
220 |
Q |
| |
|
|| |||||||||||||||||||| |
|
|
| T |
4261167 |
ttcagttcgttgatggaagcatt |
4261189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 78 - 216
Target Start/End: Original strand, 1194441 - 1194578
Alignment:
| Q |
78 |
agtaatatgtttattctagtgatggacctaattctgttacggttacacctctcttggatggaagcaacaaccttgcttgggctcaagcaatgcgttgtgc |
177 |
Q |
| |
|
|||| |||||| || |||||||||||||||||| ||||| ||||||||| | || ||| ||||||| | ||| |||||||| ||| || ||| |||| |
|
|
| T |
1194441 |
agtactatgttcatcctagtgatggacctaattttgtta-ggttacaccaattttagataaaagcaactatctttcttgggcttgagccattcgtcgtgc |
1194539 |
T |
 |
| Q |
178 |
tttaggttctaagaacaagtttaagttcgttgatggaag |
216 |
Q |
| |
|
|||||| |||||||||||||| | || ||||||||||| |
|
|
| T |
1194540 |
tttaggggctaagaacaagtttcaatttgttgatggaag |
1194578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 131 - 216
Target Start/End: Original strand, 27664401 - 27664486
Alignment:
| Q |
131 |
ttggatggaagcaacaaccttgcttgggctcaagcaatgcgttgtgctttaggttctaagaacaagtttaagttcgttgatggaag |
216 |
Q |
| |
|
||||||||||||||| | |||||||||| |||| | ||| || |||| ||| || ||||||||| |||| ||||||||||| |||| |
|
|
| T |
27664401 |
ttggatggaagcaactatcttgcttgggatcaaacgatgtgtcgtgcattaagtgctaagaacatgtttcagttcgttgatcgaag |
27664486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University