View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16545_low_15 (Length: 216)
Name: NF16545_low_15
Description: NF16545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16545_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 16 - 177
Target Start/End: Complemental strand, 40182079 - 40181918
Alignment:
| Q |
16 |
cataggttagagttcaacattctcaatcgctcagtaaacctaaacctagccgtgtgtgtgccgtttgtctccaaccgattctcactcgcaaactatatat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40182079 |
cataggttagagttcaacattctcaatcgctcagtaaacctaaacctagccgtgtgtgtgccgtctgtctccaaccgattctcactcgcaaactatatat |
40181980 |
T |
|
| Q |
116 |
aagaagatgtgggtgtcgtttgcagcaagatatggcaggaactacatcacttcttcttcttc |
177 |
Q |
| |
|
| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40181979 |
atgcagatgtgggtgtcgtttgcagcaagatatggcaggaactacatcacttcttcttcttc |
40181918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University