View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16545_low_6 (Length: 352)
Name: NF16545_low_6
Description: NF16545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16545_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 6e-59; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 10 - 149
Target Start/End: Complemental strand, 38583061 - 38582922
Alignment:
| Q |
10 |
aaatgaattattaggtgaaattaatcttgtagatgaacgctagttaccttatctacccaaattcttttttaccatgaagcattttaaagcttcttgtatg |
109 |
Q |
| |
|
|||||||| ||| ||||||| || ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38583061 |
aaatgaatcattgggtgaaacgaaccttgtagattaacgctagttaccttatctacccaaattcttttttaccatgaagcattttaaagcttcttgtatg |
38582962 |
T |
|
| Q |
110 |
tgaaattgacttcaaatattcccagatgatgaaagtagtc |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38582961 |
tgaaattgacttcaaatattcccagatgatgaaagtagtc |
38582922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 214 - 352
Target Start/End: Complemental strand, 38582860 - 38582721
Alignment:
| Q |
214 |
catcttgatttttt-ctccgcaaggcaagcttttaaaattgattatggattttaannnnnnngaatggaacattgattgtagatgtagatatagagttgc |
312 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
38582860 |
catcttgatttttttctccgcaaggcaagcttttaaaattgattatggattttaatttttttgaatggaacattgattatagatgtagatatatagttgc |
38582761 |
T |
|
| Q |
313 |
actaacatatgagaatcagagatatcaaaaacttatgtct |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38582760 |
actaacatatgagaatcagagatatcaaaaacttatgtct |
38582721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University