View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16546_high_15 (Length: 342)
Name: NF16546_high_15
Description: NF16546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16546_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 116 - 220
Target Start/End: Original strand, 17819772 - 17819878
Alignment:
| Q |
116 |
gcgtaaatgcagtagtgttcctagtttgaatgtaggagcaaatatttagtatataggt--tgtgtattctcgaatgacaggtgagtttgatgaaatcaca |
213 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| ||| |||| |||||| ||| ||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
17819772 |
gcgtaaatgcagtagtgtacctagtttgaatgtaggagcaaagattcagtacataggttatgtatattctcaaatgacgggtgagtttgatgaaatcaca |
17819871 |
T |
 |
| Q |
214 |
gtaacac |
220 |
Q |
| |
|
||||||| |
|
|
| T |
17819872 |
gtaacac |
17819878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University