View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16546_low_15 (Length: 348)
Name: NF16546_low_15
Description: NF16546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16546_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 48 - 329
Target Start/End: Complemental strand, 42359088 - 42358798
Alignment:
| Q |
48 |
taagataatagtagttatttgtcaccttttgttgcggcatatatgagccaaataggagatgacgtcgccagtaaaccaaccgtgtattgcggacgacacg |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42359088 |
taagataatagtagttatttgtcaccttttgttgcggcatatatgagccaaataggagatgacgtcgccagtaaaccaaccgtgtattgcggacgacacg |
42358989 |
T |
|
| Q |
148 |
ttcactatccttccttctatccctgtctcctttgccgtttcaaccatcttcttcatcaacatttttgtcaacacaaaatgacctgcaccacaatat--at |
245 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
42358988 |
ttcactatccttccttcaatccctgtctcctttgccgtttcaaccatcttcttcatcaacatttttgtcaacacaaaatgacctgcaccacaatattaat |
42358889 |
T |
|
| Q |
246 |
taatta-attaaattatatgcatatcaaat------nnnnnnntttgttgtaatcttactcacctaaataattagtggcaaaggtcatttc |
329 |
Q |
| |
|
|||||| |||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42358888 |
taattatattatattatatgcatatcaaattaaaaaaataaaaattgttgtaatcttactcacctaaataattagtggcaaaggtcatttc |
42358798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University