View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16546_low_16 (Length: 343)
Name: NF16546_low_16
Description: NF16546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16546_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 329
Target Start/End: Original strand, 1847057 - 1847378
Alignment:
| Q |
1 |
accaacgccctcaaacttctcggtgcatgacatcaatagttcagttggatggtgaataaattgaagagctactactgtcaagaggccgatgcttggccaa |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | | |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1847057 |
accaacaccctcaaacttctcggtgcatgacatactcaat--agttggatggtgaataaatttaagagctactactgtcaagaggccgatgcttggcca- |
1847153 |
T |
 |
| Q |
101 |
atctctgtggtggcgttggattgcttatggatggatcagatgagaagattttctacaactctagtacaactgttggagtgttactccttaagatcagtca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1847154 |
----ctgtggtggcgttggattgcttatggatggatcagatgagaagattttctacaactctagtacaactgttggagtgttactccttaagatcagtca |
1847249 |
T |
 |
| Q |
201 |
tcgaagggctgctatttcgcagtccaatgaagatttgtctttacccctctcctaatgctggtttccttaggctgtagactgtgttgtgattactcatggg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1847250 |
tcgaagggctgctatttcgcagtccaatgaagatttgtctttacccctctcctaatgctggtttccttagactgtagactgtgttgtgattactcatggg |
1847349 |
T |
 |
| Q |
301 |
gctaaagcggtttgtgggagttcagtttg |
329 |
Q |
| |
|
|||||||||||||||||||||| |||||| |
|
|
| T |
1847350 |
gctaaagcggtttgtgggagtttagtttg |
1847378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University