View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16546_low_19 (Length: 310)
Name: NF16546_low_19
Description: NF16546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16546_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 4e-66; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 32626959 - 32627106
Alignment:
| Q |
1 |
ccaactgcaataatcagggctccaatgatactgtaatcaacaaatagagaacatcaataaggttatttttagtgaatttgacatttatcaaaactctacg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32626959 |
ccaactgcaataatcagggctccaatgatactgtaatcaacaaatagagaacatcaataagattatttttagtgaatttgacatttatcaaaaccctacg |
32627058 |
T |
 |
| Q |
101 |
aagccggacactccttagattaagtgtgt-cctgatgtttgacatgtg |
147 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
32627059 |
aagccggacactccttagattaagtgtgtccctgatgttggacatgtg |
32627106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University