View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16546_low_21 (Length: 301)
Name: NF16546_low_21
Description: NF16546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16546_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 11 - 138
Target Start/End: Original strand, 9581024 - 9581151
Alignment:
| Q |
11 |
cacagaatggtttacgtatcctggtgtttggacaacatatattctcatcctcttcttttcatggatcatggttttgtctgtctttggttgttctcctggg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9581024 |
cacagaatggtttacgtatcctggtgtttggacaacatatattctcatcctcttcttttcatggatcatggttttgtctgtctttggttgttctcctggg |
9581123 |
T |
|
| Q |
111 |
attgcttggactattgttaatctcgctc |
138 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
9581124 |
attgcttggactattgttaatctcgctc |
9581151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University