View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16546_low_24 (Length: 293)
Name: NF16546_low_24
Description: NF16546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16546_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 12 - 84
Target Start/End: Original strand, 27357761 - 27357833
Alignment:
| Q |
12 |
agagataccaaagaggtggttgatgaaatcaagataatgtcttggaaataaggtttgagtagtactgattttt |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27357761 |
agagataccaaagaggtggttgatgaaatcaagataatgtcttggaaataaggtttgagtagtactgattttt |
27357833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 237 - 276
Target Start/End: Original strand, 26544137 - 26544176
Alignment:
| Q |
237 |
gtttaggcatacgattaatgagtgacaaatttacgtgaat |
276 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
26544137 |
gtttatgcatacgattaatgagtgacaaatttatgtgaat |
26544176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University