View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16546_low_28 (Length: 274)
Name: NF16546_low_28
Description: NF16546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16546_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 11 - 258
Target Start/End: Complemental strand, 930364 - 930117
Alignment:
| Q |
11 |
aagaactagaaaatattgatcagaacaacgaagagtatagaggatcatacaggcatccgtgcatatattggtctccggtatagatgttgtaaacccaata |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
930364 |
aagaactagaaaatattgatcagaacaacgaagagtatagaggatcatacaggcatccgtgcatatattggtctccggtatagatgttgtaaacccaata |
930265 |
T |
 |
| Q |
111 |
agctacgatcgatcattccaacgacattgcaggctggtccagtgtcgcctcttactccacatttaacctaacacatgtttagatagatacttaaatcaca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
930264 |
agctacgatcgatcattccaacgacattgcaggctggtccagtgtcacctcttactccacatttaacctaacacatgtttagatagatacttaaatcaca |
930165 |
T |
 |
| Q |
211 |
ttttcaaccaatatataagaagttaacttgtttcgaaaaatgaattta |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
930164 |
ttttcaaccaatatataagaagttaacttgtttcgaaaaatgaattta |
930117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University