View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16546_low_31 (Length: 259)
Name: NF16546_low_31
Description: NF16546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16546_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 3 - 116
Target Start/End: Complemental strand, 6342741 - 6342628
Alignment:
| Q |
3 |
aaacatttaagcatatgtcaaatcatataaatacattacatgcatgcttttaaaaatgcgacaaaacttgggcttagtatagagtgagaaagtttgatag |
102 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
6342741 |
aaacatttaagcatatgttaaatcatataaatacattacatgcatgcttttaaaaatgcgataaaacttgggcttagtatggagtgagagagtttgatag |
6342642 |
T |
|
| Q |
103 |
gtcttttactctga |
116 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
6342641 |
gtcttttactctga |
6342628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 115 - 244
Target Start/End: Complemental strand, 6342583 - 6342453
Alignment:
| Q |
115 |
gattattatcatacattaaaaacaccaaatacttttttattt-catctcgatttctctattctctcctctcttggtatttgacatctagacnnnnnnnga |
213 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
6342583 |
gattattatcatccattaaaaacactaaatactttttttttttcatctcgatttctctattctctcctctcttggtatttgacatctagactttttttga |
6342484 |
T |
|
| Q |
214 |
cttaatcgctttcaagttttattgttccatg |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6342483 |
cttaatcgctttcaagttttattgttccatg |
6342453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University