View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16546_low_33 (Length: 254)
Name: NF16546_low_33
Description: NF16546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16546_low_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 16 - 243
Target Start/End: Original strand, 43089055 - 43089282
Alignment:
| Q |
16 |
gttattccccaatctgattcgttataatttctttgatttggaatgtataactgagatggagtaacttgaagtggagaagaaagtgtttgaaatgaagggt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43089055 |
gttattccccaatctgattcgttataatttctttgatttggaatgtataactgagatggagtaacttgaagtggagaagaaagtgtttgaaatgaagggt |
43089154 |
T |
 |
| Q |
116 |
catctccaaaatctgaaattgatgtattgcttcttctagaccttgattttggtcttccagtatcaacttctactatttttggacttccaatatcataact |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43089155 |
catctccaaaatctgaaattgatgtattgcttcttctagaccttgattttggtcttccagtatcaacttctactatttttggacttccaatatcataact |
43089254 |
T |
 |
| Q |
216 |
gttcattgtagcatcaaaagatgatgat |
243 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
43089255 |
gttcattgtagcatcaaaagatgatgat |
43089282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University