View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16546_low_34 (Length: 230)
Name: NF16546_low_34
Description: NF16546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16546_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 22 - 217
Target Start/End: Complemental strand, 49827926 - 49827731
Alignment:
| Q |
22 |
atccttagtgccaaggtggagaattgttgggctgtggtgctaaacggttgtgcattttgttttcttttgttttgtgtcatcaatatgaggaacgttgtac |
121 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
49827926 |
atccttggtgccaaggtggagaattgttgggctgtggtgctaaacggttgtgcatttcgttttcttttgttttgtgtcatcaagcttaggaacgttgtac |
49827827 |
T |
 |
| Q |
122 |
ttgtgctgggaaagttatttacatcttcctaaccgtttctgttgtatgtagttgaaaattggttgtaaatgaatctactatatgtagtttcatatc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49827826 |
ttgtgctgggaaagttatttacatcttcctaaccgtttctgttgtatgtagttgaaaattggttgtaaatgaatctactatatgtagtttcatatc |
49827731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University