View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16546_low_8 (Length: 409)
Name: NF16546_low_8
Description: NF16546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16546_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 1e-91; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 216 - 390
Target Start/End: Complemental strand, 19190286 - 19190112
Alignment:
| Q |
216 |
tccataaccactgttagatcggttatcaagaccgtaaccaccacctgtagtaccaccaccataacgtccataaccactctcatgatacttattatcctta |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19190286 |
tccataaccactgttagatcggttatcaagaccgtaaccaccacctgtagtaccaccaccataacgtccataaccactctcatgatacttattatcctta |
19190187 |
T |
|
| Q |
316 |
tttccataataaccaccatttccaccaaacccaccaccagaataaccattttttcgtccggtaggaacaccggag |
390 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
19190186 |
tttccataataaccaccatttccaccaaacccaccaccagaataacccttttttcgtccggtaggaacaccggag |
19190112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 133; E-Value: 5e-69
Query Start/End: Original strand, 11 - 151
Target Start/End: Complemental strand, 19190491 - 19190351
Alignment:
| Q |
11 |
catcatcatatccacccccagaacgcccatatccactctcataacggtcattagcgccataaccaccaccagaacggtcatcggaaccataaccaccacc |
110 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19190491 |
catcaccatatccaccaccagaacgcccatatccactctcataacggtcattagcgccataaccaccaccagaacggtcatcggaaccataaccaccacc |
19190392 |
T |
|
| Q |
111 |
aaaacgtccacctccatacccgctctcgttattattcccat |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19190391 |
aaaacgtccacctccatacccgctctcgttattattcccat |
19190351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University