View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16547_high_6 (Length: 283)
Name: NF16547_high_6
Description: NF16547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16547_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 13 - 250
Target Start/End: Complemental strand, 34608683 - 34608449
Alignment:
| Q |
13 |
atcatcacctcaccatagttcagcagaaccaggcagacgacatgcatatcgacatatcaacctcaataggcggcatatctaagcagctcaataatcatcc |
112 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34608683 |
atcatcacctcaccacaattcagcagaaccaggcagacaacatgcatatcggcatatcaacctcaataggcggcatatctaagcagctcaat---catcc |
34608587 |
T |
 |
| Q |
113 |
tctcagaccaaccatatcattttttaatctttcaaattcatttaccaaggcactacaactatcaatgatcaaacatttcttggacttgattaacttgtac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34608586 |
tctcagaccaaccatatcattttttaatctttcaaattcatttaccaaggcactacaactatcaatgatcaaacatttcttggacttgattaacttgtac |
34608487 |
T |
 |
| Q |
213 |
gaaaacaaaagatttaaaagtgagcataacaactatgg |
250 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
34608486 |
gaaaacaaaagatttaaaagcgagcataacaacgatgg |
34608449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University