View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16547_low_8 (Length: 255)
Name: NF16547_low_8
Description: NF16547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16547_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 100 - 231
Target Start/End: Complemental strand, 183432 - 183299
Alignment:
| Q |
100 |
gactatgtgaaatgtggaccctgnnnnnnntaaaa--gagtgcagtatagaaaagggacactatggtgtctgaatggtggagataatccattccaaatac |
197 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
183432 |
gactatgtgaaatgtggaccctgaaaaaaataaaaaagagtgcagtatagaaaagggacactatggtgtttgaatggtggagataatccattccaaatac |
183333 |
T |
|
| Q |
198 |
agaaaatttaggattctccaaaatgaaaatccct |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
183332 |
agaaaatttaggattctccaaaatgaaaatccct |
183299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 78 - 107
Target Start/End: Complemental strand, 183482 - 183453
Alignment:
| Q |
78 |
aaatatttagacgaggaaaaaggactatgt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
183482 |
aaatatttagacgaggaaaaaggactatgt |
183453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University