View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16548_low_9 (Length: 235)
Name: NF16548_low_9
Description: NF16548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16548_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 9)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 8610728 - 8610529
Alignment:
| Q |
1 |
ctccttcttttgttgctttctctggtgatcaaaggttgaccggtgatgcggcgaaaaatcaagctgcttcaaacccagctaacacagtctttggtaacta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8610728 |
ctccttcttttgttgctttctctggtgatcaaaggttgataggtgatgctgctaaaaatcaagctgcttcaaacccagctaacacagtctttggtaacta |
8610629 |
T |
 |
| Q |
101 |
atttatccnnnnnnnnnnnnnnngtttcttgcatggttttttaaattgatttagatactatagtttaaatgctatgctttttatgaaaaatataaaatta |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8610628 |
atttatc--------ttttttttctttcttgcatggttttttaaattgatttagatactatagtttatctgctatgctttttatgaaaaatataaaatta |
8610537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 8602798 - 8602702
Alignment:
| Q |
1 |
ctccttcttttgttgctttctctggtgatcaaaggttgaccggtgatgcggcgaaaaatcaagctgcttcaaacccagctaacacagtctttggtaa |
97 |
Q |
| |
|
||||||||||||||||||| ||| |||| ||||||||| ||||||||| || |||||||| |||||||| ||||||| ||||| |||||||||| |
|
|
| T |
8602798 |
ctccttcttttgttgcttttactgatgataaaaggttgatcggtgatgctgccaaaaatcaggctgcttctaacccagtcaacactatctttggtaa |
8602702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 3 - 97
Target Start/End: Complemental strand, 8647763 - 8647669
Alignment:
| Q |
3 |
ccttcttttgttgctttctctggtgatcaaaggttgaccggtgatgcggcgaaaaatcaagctgcttcaaacccagctaacacagtctttggtaa |
97 |
Q |
| |
|
|||||||||||||||||| | | |||||||||||||| |||||||| || |||||||| |||||||| ||||| | ||||| ||||||||||| |
|
|
| T |
8647763 |
ccttcttttgttgctttcaccgatgatcaaaggttgattggtgatgccgctaaaaatcaggctgcttctaaccctaccaacactgtctttggtaa |
8647669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 3 - 99
Target Start/End: Original strand, 7876874 - 7876970
Alignment:
| Q |
3 |
ccttcttttgttgctttctctggtgatcaaaggttgaccggtgatgcggcgaaaaatcaagctgcttcaaacccagctaacacagtctttggtaact |
99 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||| |||||||| || |||||||| ||||| || |||||| | ||||| ||||||||||||| |
|
|
| T |
7876874 |
ccttcttttgttgctttcacgaatgatcaaaggttgattggtgatgctgccaaaaatcaggctgcctctaacccatccaacactgtctttggtaact |
7876970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 3 - 97
Target Start/End: Complemental strand, 8591460 - 8591366
Alignment:
| Q |
3 |
ccttcttttgttgctttctctggtgatcaaaggttgaccggtgatgcggcgaaaaatcaagctgcttcaaacccagctaacacagtctttggtaa |
97 |
Q |
| |
|
||||||||||||||||| || |||||||||||||| |||||||| || ||||| || |||||||| |||||||| ||||| ||||| ||||| |
|
|
| T |
8591460 |
ccttcttttgttgcttttactaatgatcaaaggttgattggtgatgctgcaaaaaaccaggctgcttctaacccagcaaacactgtcttcggtaa |
8591366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 17261456 - 17261360
Alignment:
| Q |
1 |
ctccttcttttgttgctttctctggtgatcaaaggttgaccggtgatgcggcgaaaaatcaagctgcttcaaacccagctaacacagtctttggtaa |
97 |
Q |
| |
|
||||||||||||||||||| || ||| ||||||||| ||||||||| || || ||||||||||| |||||||| ||||| ||||||||||| |
|
|
| T |
17261456 |
ctccttcttttgttgcttttgctaaagatgaaaggttgatcggtgatgccgctaagaatcaagctgccataaacccagaaaacaccgtctttggtaa |
17261360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 3 - 65
Target Start/End: Complemental strand, 3148433 - 3148371
Alignment:
| Q |
3 |
ccttcttttgttgctttctctggtgatcaaaggttgaccggtgatgcggcgaaaaatcaagct |
65 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||| |||||||| || || ||||||||| |
|
|
| T |
3148433 |
ccttcttttgttgctttcactgatgatcaaaggttggttggtgatgctgctaagaatcaagct |
3148371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 6 - 67
Target Start/End: Complemental strand, 1302370 - 1302309
Alignment:
| Q |
6 |
tcttttgttgctttctctggtgatcaaaggttgaccggtgatgcggcgaaaaatcaagctgc |
67 |
Q |
| |
|
||||||||||||||| | | |||||||||||||| ||||||||| || || ||||| ||||| |
|
|
| T |
1302370 |
tcttttgttgctttcaccgatgatcaaaggttgatcggtgatgctgctaagaatcaggctgc |
1302309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 67
Target Start/End: Complemental strand, 6790472 - 6790408
Alignment:
| Q |
3 |
ccttcttttgttgctttctctggtgatcaaaggttgaccggtgatgcggcgaaaaatcaagctgc |
67 |
Q |
| |
|
|||||||||||||||||| | | ||| |||||||||| ||||||||| || || |||||||||| |
|
|
| T |
6790472 |
ccttcttttgttgctttcaccgatgaccaaaggttgatcggtgatgctgctaagtatcaagctgc |
6790408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 3 - 63
Target Start/End: Original strand, 16656640 - 16656700
Alignment:
| Q |
3 |
ccttcttttgttgctttctctggtgatcaaaggttgaccggtgatgcggcgaaaaatcaag |
63 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||| ||||||||| || || ||||||| |
|
|
| T |
16656640 |
ccttcttttgttgctttcactcatgatcaaaggttgatcggtgatgctgctaagaatcaag |
16656700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 3 - 68
Target Start/End: Original strand, 12244443 - 12244508
Alignment:
| Q |
3 |
ccttcttttgttgctttctctggtgatcaaaggttgaccggtgatgcggcgaaaaatcaagctgct |
68 |
Q |
| |
|
||||||| |||||||||| ||| ||||||||||| | |||||||| || ||||||||||||||| |
|
|
| T |
12244443 |
ccttcttgtgttgctttcactgaagatcaaaggtttattggtgatgctgctaaaaatcaagctgct |
12244508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University