View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16548_low_9 (Length: 235)

Name: NF16548_low_9
Description: NF16548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16548_low_9
NF16548_low_9
[»] chr7 (9 HSPs)
chr7 (1-208)||(8610529-8610728)
chr7 (1-97)||(8602702-8602798)
chr7 (3-97)||(8647669-8647763)
chr7 (3-99)||(7876874-7876970)
chr7 (3-97)||(8591366-8591460)
chr7 (1-97)||(17261360-17261456)
chr7 (3-65)||(3148371-3148433)
chr7 (6-67)||(1302309-1302370)
chr7 (3-67)||(6790408-6790472)
[»] chr2 (2 HSPs)
chr2 (3-63)||(16656640-16656700)
chr2 (3-68)||(12244443-12244508)


Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 9)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 8610728 - 8610529
Alignment:
1 ctccttcttttgttgctttctctggtgatcaaaggttgaccggtgatgcggcgaaaaatcaagctgcttcaaacccagctaacacagtctttggtaacta 100  Q
    |||||||||||||||||||||||||||||||||||||||  |||||||| || |||||||||||||||||||||||||||||||||||||||||||||||    
8610728 ctccttcttttgttgctttctctggtgatcaaaggttgataggtgatgctgctaaaaatcaagctgcttcaaacccagctaacacagtctttggtaacta 8610629  T
101 atttatccnnnnnnnnnnnnnnngtttcttgcatggttttttaaattgatttagatactatagtttaaatgctatgctttttatgaaaaatataaaatta 200  Q
    |||||||                 |||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||    
8610628 atttatc--------ttttttttctttcttgcatggttttttaaattgatttagatactatagtttatctgctatgctttttatgaaaaatataaaatta 8610537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 8602798 - 8602702
Alignment:
1 ctccttcttttgttgctttctctggtgatcaaaggttgaccggtgatgcggcgaaaaatcaagctgcttcaaacccagctaacacagtctttggtaa 97  Q
    |||||||||||||||||||  ||| |||| ||||||||| ||||||||| || |||||||| |||||||| |||||||  |||||  ||||||||||    
8602798 ctccttcttttgttgcttttactgatgataaaaggttgatcggtgatgctgccaaaaatcaggctgcttctaacccagtcaacactatctttggtaa 8602702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 3 - 97
Target Start/End: Complemental strand, 8647763 - 8647669
Alignment:
3 ccttcttttgttgctttctctggtgatcaaaggttgaccggtgatgcggcgaaaaatcaagctgcttcaaacccagctaacacagtctttggtaa 97  Q
    |||||||||||||||||| | | ||||||||||||||  |||||||| || |||||||| |||||||| |||||  | ||||| |||||||||||    
8647763 ccttcttttgttgctttcaccgatgatcaaaggttgattggtgatgccgctaaaaatcaggctgcttctaaccctaccaacactgtctttggtaa 8647669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 3 - 99
Target Start/End: Original strand, 7876874 - 7876970
Alignment:
3 ccttcttttgttgctttctctggtgatcaaaggttgaccggtgatgcggcgaaaaatcaagctgcttcaaacccagctaacacagtctttggtaact 99  Q
    |||||||||||||||||| |   ||||||||||||||  |||||||| || |||||||| ||||| || |||||| | ||||| |||||||||||||    
7876874 ccttcttttgttgctttcacgaatgatcaaaggttgattggtgatgctgccaaaaatcaggctgcctctaacccatccaacactgtctttggtaact 7876970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 3 - 97
Target Start/End: Complemental strand, 8591460 - 8591366
Alignment:
3 ccttcttttgttgctttctctggtgatcaaaggttgaccggtgatgcggcgaaaaatcaagctgcttcaaacccagctaacacagtctttggtaa 97  Q
    |||||||||||||||||  ||  ||||||||||||||  |||||||| || ||||| || |||||||| |||||||| ||||| ||||| |||||    
8591460 ccttcttttgttgcttttactaatgatcaaaggttgattggtgatgctgcaaaaaaccaggctgcttctaacccagcaaacactgtcttcggtaa 8591366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 17261456 - 17261360
Alignment:
1 ctccttcttttgttgctttctctggtgatcaaaggttgaccggtgatgcggcgaaaaatcaagctgcttcaaacccagctaacacagtctttggtaa 97  Q
    |||||||||||||||||||  ||   ||| ||||||||| ||||||||| || || |||||||||||   ||||||||  ||||| |||||||||||    
17261456 ctccttcttttgttgcttttgctaaagatgaaaggttgatcggtgatgccgctaagaatcaagctgccataaacccagaaaacaccgtctttggtaa 17261360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 3 - 65
Target Start/End: Complemental strand, 3148433 - 3148371
Alignment:
3 ccttcttttgttgctttctctggtgatcaaaggttgaccggtgatgcggcgaaaaatcaagct 65  Q
    |||||||||||||||||| ||| |||||||||||||   |||||||| || || |||||||||    
3148433 ccttcttttgttgctttcactgatgatcaaaggttggttggtgatgctgctaagaatcaagct 3148371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 6 - 67
Target Start/End: Complemental strand, 1302370 - 1302309
Alignment:
6 tcttttgttgctttctctggtgatcaaaggttgaccggtgatgcggcgaaaaatcaagctgc 67  Q
    ||||||||||||||| | | |||||||||||||| ||||||||| || || ||||| |||||    
1302370 tcttttgttgctttcaccgatgatcaaaggttgatcggtgatgctgctaagaatcaggctgc 1302309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 67
Target Start/End: Complemental strand, 6790472 - 6790408
Alignment:
3 ccttcttttgttgctttctctggtgatcaaaggttgaccggtgatgcggcgaaaaatcaagctgc 67  Q
    |||||||||||||||||| | | ||| |||||||||| ||||||||| || ||  ||||||||||    
6790472 ccttcttttgttgctttcaccgatgaccaaaggttgatcggtgatgctgctaagtatcaagctgc 6790408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 3 - 63
Target Start/End: Original strand, 16656640 - 16656700
Alignment:
3 ccttcttttgttgctttctctggtgatcaaaggttgaccggtgatgcggcgaaaaatcaag 63  Q
    |||||||||||||||||| ||  |||||||||||||| ||||||||| || || |||||||    
16656640 ccttcttttgttgctttcactcatgatcaaaggttgatcggtgatgctgctaagaatcaag 16656700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 3 - 68
Target Start/End: Original strand, 12244443 - 12244508
Alignment:
3 ccttcttttgttgctttctctggtgatcaaaggttgaccggtgatgcggcgaaaaatcaagctgct 68  Q
    ||||||| |||||||||| |||  ||||||||||| |  |||||||| || |||||||||||||||    
12244443 ccttcttgtgttgctttcactgaagatcaaaggtttattggtgatgctgctaaaaatcaagctgct 12244508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University