View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16549_high_26 (Length: 387)
Name: NF16549_high_26
Description: NF16549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16549_high_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 1 - 372
Target Start/End: Complemental strand, 29274254 - 29273881
Alignment:
| Q |
1 |
aaacacgtttcatgcaagttcggtggttgaatcacgttcaatgattgtgttgggaggatcgcaagagatagtgccgtacatccactgtaaacacaa--ac |
98 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| || |
|
|
| T |
29274254 |
aaacatgtttcatgcaagttcggtggttgaatcacgttcaatgattgtgttgggaagatcgcaagagatagtgccgtaaatccactgtaaacacaacaac |
29274155 |
T |
 |
| Q |
99 |
atcaaagacatgaaatcgacttcttatcattctttgaaggaggaatgatatgatcaagaacacgataagccctaacatggattttaaagagcatcggcca |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29274154 |
atcaaagacatgaaatcgacttcttatcattctttgaaggaggaattgtatgatcaagaacacgataagccctaacatggattttaaagagcatcggcca |
29274055 |
T |
 |
| Q |
199 |
agtaactctattcagtatctaacgtggctttgatgaagttgataatattaaggatcataagagcgggaaggaggagtaggtgaggtaggagaaggattag |
298 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29274054 |
agtaaccctattcagtatctaacgtggctttgatgaagttgataatattagggatcataagagcgggaaggaggagtaggtgaggtaggagaaggattag |
29273955 |
T |
 |
| Q |
299 |
tcgatgggtataagaagggtcggtgtttggcatggtggtggagtttgaatgagaaggtaggtaaggtggctgat |
372 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29273954 |
tcgatgggtataagaagggtcagtgtttggcatggtggtggagtttgaatgagaaggtaggtaaggtggctgat |
29273881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University