View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16549_high_42 (Length: 259)
Name: NF16549_high_42
Description: NF16549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16549_high_42 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 22 - 232
Target Start/End: Complemental strand, 19856830 - 19856620
Alignment:
| Q |
22 |
gaaaaggtgtagagctttggtgaaaaaggttaatacttttgttggaaagataatagaggagcataagatgaagagaatgtctgaaggaagggctatagtt |
121 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19856830 |
gaaaaggtgtagagctttggtgacaaaggttaatacttttgttggaaagataatagaggagcataagatgaagagaatgtctgaaggaagggctatagtt |
19856731 |
T |
|
| Q |
122 |
ggtgattttgttgacgttttgcttgatttggaggaaaaagacaagctcagtgattctgatatgattgcagttctttgggtaatacaatatttctttacat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
19856730 |
ggtgattttgttgacgttttgcttgatttggaggaaaaagacaagctcagtgattctgatatgattgcagttctttgggtaatacaatatttctttatac |
19856631 |
T |
|
| Q |
222 |
gtttttaatat |
232 |
Q |
| |
|
||||||||||| |
|
|
| T |
19856630 |
gtttttaatat |
19856620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University