View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16549_low_32 (Length: 377)
Name: NF16549_low_32
Description: NF16549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16549_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 25 - 360
Target Start/End: Original strand, 6080731 - 6081069
Alignment:
| Q |
25 |
agaactcattgagcatatgttttcaaatgagtttgtaggattttttatgggttctttgttcatagaaatagannnnnnnnnnnn---gttattttgggtg |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
6080731 |
agaactcattgagcatatgttttcaaatgagtttgtaggattttttatgggttctttgttc-tagaaatagatttttttttttttttgttattttgggtg |
6080829 |
T |
 |
| Q |
122 |
ttggattttggactactagatagttcattgagatagcaacggctgagagataaattgacactccttgttcacact-aaaccaatttcagttacacggctg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
6080830 |
ttggattttggactactagatagttcattgagatagcaacggctgagagataaattgacactccttgttcacacacaaaccaatttcaattacacggctg |
6080929 |
T |
 |
| Q |
221 |
aatcatcgatatagttactgtcagtttttgaaaaccaccagccataggtgtagaacctggaaatccttttgtttcggtcatttgagccttaaccggtaaa |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
6080930 |
aatcatcgatatagttactgtcagtttttgaaaaccaccagccataggtgtagaacctggaaatccttttgcttcggtcatttgagccttaaccagtaaa |
6081029 |
T |
 |
| Q |
321 |
atccaaccctcatgtgtttacgtagtagtggttatcaaat |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6081030 |
atccaaccctcatgtgtttacgtagtagtggttatcaaat |
6081069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University