View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16549_low_36 (Length: 333)

Name: NF16549_low_36
Description: NF16549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16549_low_36
NF16549_low_36
[»] chr4 (2 HSPs)
chr4 (18-326)||(27908160-27908467)
chr4 (214-307)||(31306589-31306682)
[»] chr5 (1 HSPs)
chr5 (206-326)||(40493082-40493201)
[»] chr8 (3 HSPs)
chr8 (212-307)||(33772936-33773031)
chr8 (212-309)||(36459855-36459952)
chr8 (212-246)||(33775031-33775065)
[»] chr7 (1 HSPs)
chr7 (220-305)||(42609683-42609768)
[»] chr1 (1 HSPs)
chr1 (217-305)||(25948399-25948487)
[»] chr3 (1 HSPs)
chr3 (212-305)||(42075576-42075669)


Alignment Details
Target: chr4 (Bit Score: 287; Significance: 1e-161; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 18 - 326
Target Start/End: Complemental strand, 27908467 - 27908160
Alignment:
18 ccataaaagtaacctaatccaaattccaaacacacacacccatagtttttctttgttgttttatcagtagaattttcacaaataatttcaattgtaaaac 117  Q
    |||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
27908467 ccataaaagtaacctaatccaaattccaaacacacac--ccatagtttttctttgttgttttattagtagaattttcacaaataatttcaattgtaaaac 27908370  T
118 ctagcagacacgaa-ttttaataaaacccttaaaataaatcgagtaagcaaaattaaaagtaacaaaatcagcgatcataagaaaccctaactaacctgg 216  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27908369 ctagcagacacgaaattttaataaaacccttaaaataaatcgagtaagcaaaattaaaagtaacaaaatcagcgatcataagaaaccctaactaacctgg 27908270  T
217 atcttggccttgacgttgtcgatggtgtcgctactctcaacctcgagagtgatagtctttccggtcaaagttttgacgaagatctgcatcttgttgttct 316  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27908269 atcttggccttgacgttgtcgatggtgtcgctactctcaacctcgagagtgatagtctttccggtcaaagttttgacgaagatctgcatcttgttgttct 27908170  T
317 tcttcttctc 326  Q
    ||||||||||    
27908169 tcttcttctc 27908160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 214 - 307
Target Start/End: Original strand, 31306589 - 31306682
Alignment:
214 tggatcttggccttgacgttgtcgatggtgtcgctactctcaacctcgagagtgatagtctttccggtcaaagttttgacgaagatctgcatct 307  Q
    ||||||||||||||||| || || || || |||  |||||| ||||| |||||||| || ||||| ||||| ||||| || |||||||||||||    
31306589 tggatcttggccttgacattatcaattgtatcggaactctctacctcaagagtgatggtttttcctgtcaatgttttcacaaagatctgcatct 31306682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 206 - 326
Target Start/End: Original strand, 40493082 - 40493201
Alignment:
206 aactaacctggatcttggccttgacgttgtcgatggtgtcgctactctcaacctcgagagtgatagtctttccggtcaaagttttgacgaagatctgcat 305  Q
    |||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||||| || ||||||||||||||    
40493082 aactaacctggatcttggccttgacgttgtcgattgtgtcgctgctctcaacctcgagggtgatagtctttccggtcaaagtcttcacgaagatctgcat 40493181  T
306 cttgttgttcttcttcttctc 326  Q
    |||  | ||||||||||||||    
40493182 ctt-ctcttcttcttcttctc 40493201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 52; Significance: 9e-21; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 212 - 307
Target Start/End: Complemental strand, 33773031 - 33772936
Alignment:
212 cctggatcttggccttgacgttgtcgatggtgtcgctactctcaacctcgagagtgatagtctttccggtcaaagttttgacgaagatctgcatct 307  Q
    |||||||||| ||||| ||||||||||||||||||  ||||||||||||||||||||| |||||||| || |  ||||| |||||||| |||||||    
33773031 cctggatcttagccttaacgttgtcgatggtgtcggaactctcaacctcgagagtgatggtctttccagtgagggttttcacgaagatttgcatct 33772936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 212 - 309
Target Start/End: Complemental strand, 36459952 - 36459855
Alignment:
212 cctggatcttggccttgacgttgtcgatggtgtcgctactctcaacctcgagagtgatagtctttccggtcaaagttttgacgaagatctgcatcttg 309  Q
    ||||||||||||| ||||| |||||||| ||||||  |  |||||||||||| || || ||||| || || |  ||||| ||||||||||||||||||    
36459952 cctggatcttggctttgacattgtcgattgtgtcggaagactcaacctcgagggttatcgtcttccctgttagggttttcacgaagatctgcatcttg 36459855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 212 - 246
Target Start/End: Complemental strand, 33775065 - 33775031
Alignment:
212 cctggatcttggccttgacgttgtcgatggtgtcg 246  Q
    ||||||||||||| |||||||||||||||||||||    
33775065 cctggatcttggctttgacgttgtcgatggtgtcg 33775031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 220 - 305
Target Start/End: Original strand, 42609683 - 42609768
Alignment:
220 ttggccttgacgttgtcgatggtgtcgctactctcaacctcgagagtgatagtctttccggtcaaagttttgacgaagatctgcat 305  Q
    ||||||||||| |||||||| ||||| || |||||||||||||| ||||| || || ||||| |  ||||| ||||||||||||||    
42609683 ttggccttgacattgtcgattgtgtcactgctctcaacctcgagggtgatggttttcccggttagggttttcacgaagatctgcat 42609768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 217 - 305
Target Start/End: Complemental strand, 25948487 - 25948399
Alignment:
217 atcttggccttgacgttgtcgatggtgtcgctactctcaacctcgagagtgatagtctttccggtcaaagttttgacgaagatctgcat 305  Q
    |||||||| ||||| |||||||||||||| |||||||| || |||||||| || ||||| || || |  ||||| ||||| ||||||||    
25948487 atcttggctttgacattgtcgatggtgtcactactctcgacttcgagagtaattgtcttccctgttagggttttcacgaatatctgcat 25948399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 212 - 305
Target Start/End: Complemental strand, 42075669 - 42075576
Alignment:
212 cctggatcttggccttgacgttgtcgatggtgtcgctactctcaacctcgagagtgatagtctttccggtcaaagttttgacgaagatctgcat 305  Q
    |||| ||||| || |||||||| ||||| ||||||||   ||| ||||| || ||||||||||| ||||| |  ||||| ||||||||||||||    
42075669 cctgaatcttagctttgacgttatcgatagtgtcgcttgactccacctcaagggtgatagtcttgccggttagggttttcacgaagatctgcat 42075576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University