View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16549_low_42 (Length: 297)
Name: NF16549_low_42
Description: NF16549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16549_low_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 18 - 282
Target Start/End: Original strand, 36532912 - 36533176
Alignment:
| Q |
18 |
ggaacattgcataatatatgtaggagcagaggttcgatccctgaaaccccacttattccactacttgaccaaataaaagtgatactgatggtcaaattac |
117 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36532912 |
ggaacattgcataatatatgtaggagcggaggttcgatccctggaaccccacttattctactacttgatcaaataaaagtgatactgatggtcaaattac |
36533011 |
T |
 |
| Q |
118 |
aatcttctcgaatgggatttaaacttcgtaccttgaggttacgaggtttaattcttaccacttagctgacacttcatggatgcgtaaagtaattagttta |
217 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36533012 |
aattgtctcgaatgggatttaaacttcgtaccttgaggttacgaagtttgattcttaccacttagctgacacttcatggatgcgtaaagtaattagttta |
36533111 |
T |
 |
| Q |
218 |
gtgtaatttttaaaacaactaactttattttaatgtcaattattgttagttcaagtaagaatgtt |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36533112 |
gtgtaatttttaaaacaactaactttattttaatgtcaattattgttagttcaagtaagaatgtt |
36533176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University