View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16549_low_49 (Length: 267)
Name: NF16549_low_49
Description: NF16549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16549_low_49 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 84 - 263
Target Start/End: Complemental strand, 9298611 - 9298431
Alignment:
| Q |
84 |
cctaaatataggtagatctgaatcatgggtttttgatttttggttgaattta-gatttatgtaatttgcagattggtgtaatgatgaagtattttgacan |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9298611 |
cctaaatataggtagatctgaatcatgggtttttgatttttggttgagtttaagatttatgtaatttgcagattggtgtaatgatgaaacattttgacat |
9298512 |
T |
 |
| Q |
183 |
nnnnnncttctctcttcctcaaaaggttttcatcattacatccttttcgtgtttctttctctgattttgttatgatgatgt |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9298511 |
ttttttcttctctcttcctcaaaaggttttcatcattacatccttttcgtgtttctttctctgattttgttatgatgatgt |
9298431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 9298694 - 9298651
Alignment:
| Q |
1 |
ataggtttgatttcatttcatttctctctctaaaattatatata |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9298694 |
ataggtttgatttcatttcatttctctctctaaaattatatata |
9298651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University