View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16549_low_53 (Length: 255)
Name: NF16549_low_53
Description: NF16549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16549_low_53 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 18 - 247
Target Start/End: Original strand, 10024504 - 10024733
Alignment:
| Q |
18 |
aattttacgttttctctggttttcgtgattgtcagtaaccggcgcgagagctgatgagggggtaattttttaactgaatttttcgtttattgaacaaaat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10024504 |
aattttacgttttctctggttttcgtgattgtcagtaaccggcgcgagagctgatgaggaggtaattttttaactgaatttttcgtttattgaacaaaat |
10024603 |
T |
|
| Q |
118 |
gttgctttagaagtttttcttctaatcatttaacaatgtacagacaattgacagattaattgagaccggtgacagcgaacaaattttccagaaggctatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10024604 |
gttgctttagaagtttttcttctaatcatttaacaatgtacagacaattgacagattaattgagaccggtgacagcgaacaaattttccagaaggctatt |
10024703 |
T |
|
| Q |
218 |
caggaacaaggacgaggccaggttcatctc |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10024704 |
caggaacaaggacgaggccaggttcatctc |
10024733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University