View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16550_high_9 (Length: 225)
Name: NF16550_high_9
Description: NF16550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16550_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 85 - 211
Target Start/End: Original strand, 40121260 - 40121386
Alignment:
| Q |
85 |
gaattaaagtaggtttagaactatagttcatttcttaaaatatcacttattaattttctaaactggtttgtatttttataaatatatgcttaggaatttc |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40121260 |
gaattaaagtaggtttagaactatagttcatttcttaaaatatcacttattaattttctaaactggtttgtatttttataaatatatgcttaggaatttc |
40121359 |
T |
 |
| Q |
185 |
ttttgcaaccatttacagggttctttt |
211 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
40121360 |
ttttgcaaccatttacagggttctttt |
40121386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 16 - 61
Target Start/End: Original strand, 40121191 - 40121236
Alignment:
| Q |
16 |
attcttctaacggggttttctagaacaatctttattcagagttaca |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40121191 |
attcttctaacggggttttctagaacaatctttattcagagttaca |
40121236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University