View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16550_low_13 (Length: 220)
Name: NF16550_low_13
Description: NF16550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16550_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 13 - 200
Target Start/End: Original strand, 5849874 - 5850062
Alignment:
| Q |
13 |
gtgagatgaaattacaatgacccttttggattatgataagatgatacctacaacttgagtatatatgagggaaaaaatgtgtggttcaagagaa-gagaa |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
5849874 |
gtgacatgaaattacaatgacccttttggattatgataagatgatacctacaacttgagtatataagagggaaaaaatgtgtggttcaagagaacgagaa |
5849973 |
T |
 |
| Q |
112 |
aatgttgagaaacgtggaaggtttatagagagtatgttatgggacattcttaatttgtttgcagctagattttgatttacatatttatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5849974 |
aatgttgagaaacgtggaaggtttatagagagtatgttatgggacattcttaatttgtttgcagctagattttgatttacatatttatt |
5850062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University