View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16550_low_9 (Length: 247)
Name: NF16550_low_9
Description: NF16550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16550_low_9 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 36476629 - 36476868
Alignment:
| Q |
1 |
aaatttcatcccctggatgcaccacaaagatcatcagttcaaaatccacatgctcatatataaccctaaaagatctcaatactattactcnnnnnnnnnn |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36476629 |
aaatttcatcccctagatgcaccacaaagatcatcagttcaaaatccacatgctcatatataaccctaaaagatctcaatactattact-------tttt |
36476721 |
T |
|
| Q |
101 |
nnnaacaaattgtatatataaagtatttgtgaatattgaaaacacttaccggccaagtgtgtttataaaatactttagcatgaatatcaacccgtatggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| |
|
|
| T |
36476722 |
tttaacaaattgtatatataaagtatttgtgaatattgaaaacacttaccggccaagtgtgtttataaaatactttagcatgaatatcaacccctttggt |
36476821 |
T |
|
| Q |
201 |
ctcattggaagctggtgttgctttttggtcagtgtattgatgagaag |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36476822 |
ctcattggaagctggtgttgctttttggtcagtgtattgatgagaag |
36476868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 127 - 247
Target Start/End: Original strand, 36467121 - 36467235
Alignment:
| Q |
127 |
ttgtgaatattgaaaacacttaccggccaagtgtgtttataaaatactttagcatgaatatcaacccgtatggtctcattggaagctggtgttgcttttt |
226 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||| ||||||||||| | ||| | ||||||||||||| | |||||||| ||||| |
|
|
| T |
36467121 |
ttgtgaatattgaacactcttaccggccaagtgtgtttataaaaaactttagcatg------atcccctttggtctcattggatggtggtgttgtttttt |
36467214 |
T |
|
| Q |
227 |
ggtcagtgtattgatgagaag |
247 |
Q |
| |
|
|||| |||||||||||||||| |
|
|
| T |
36467215 |
ggtcggtgtattgatgagaag |
36467235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University