View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16551_high_29 (Length: 370)
Name: NF16551_high_29
Description: NF16551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16551_high_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 116 - 354
Target Start/End: Complemental strand, 2794149 - 2793911
Alignment:
| Q |
116 |
tctcttcaaattccactgcaacaccgtcaaaagaatcaaaaccaccctcaacatcctcaaactccagaaaatcagttataacctttccaatcgaaacaag |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2794149 |
tctcttcaaattccactgcaacaccgtcaaaagaatcaaaaccaccctccacatcctcaaactccagaaaatcagttataagctttccaatcgaaacaag |
2794050 |
T |
 |
| Q |
216 |
gtgattaaacacagtatcagtgatagggttaagcagtttctcaatgttaatcttcttgtcaccaatagagtcgtttttcagaatggaaagaatctcatca |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2794049 |
gtgattaaacacagtatcagtgatagggttaagcagtttctcaatgttaatcttcttgtcaccaacagagtcgtttttcagaatggaaagaatctcatca |
2793950 |
T |
 |
| Q |
316 |
gcagcacctctgataatcccaagcggctgaccaccaaac |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2793949 |
gcagcacctctgataatcccaagcggctgaccaccaaac |
2793911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 17 - 48
Target Start/End: Complemental strand, 2794248 - 2794217
Alignment:
| Q |
17 |
ctatttgcattgcatagtcacctatttcaaaa |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2794248 |
ctatttgcattgcatagtcacctatttcaaaa |
2794217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University