View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16551_high_47 (Length: 274)
Name: NF16551_high_47
Description: NF16551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16551_high_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 41705720 - 41705985
Alignment:
| Q |
1 |
caaagactgcggttcatttcactgtccaccattctactacgcttacggcgatggaagcttaatagcttctctctatcgcgatacactttcactttctact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41705720 |
caaagactgcggttcatttcactgtccaccattctactacgcttacggcgatggaagcttaatagcttctctctatcgcgatacactttctctttctact |
41705819 |
T |
 |
| Q |
101 |
cttcaacttacaaaattcacattcggttgtgctcatacaactttctccgaacccaccggagtcgctggcttcggtcgtggattactttctctcccagctc |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705820 |
cttcaacttacaaacttcacattcggttgtgctcatacaactttctccgaacccaccggagtcgctggcttcggtcgtggattactttctctcccagctc |
41705919 |
T |
 |
| Q |
201 |
agttagctactcactctcctcaacttggaaaccgtttttcttattgtttggtttctcattcttttc |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705920 |
agttagctactcactctcctcaacttggaaaccgtttttcttattgtttggtttctcattcttttc |
41705985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University