View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16551_high_64 (Length: 237)
Name: NF16551_high_64
Description: NF16551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16551_high_64 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 29197869 - 29197649
Alignment:
| Q |
1 |
cattgcaactattgatgctcgttttgattcaaaatccttcatcactcaagtgatctcctccaatgatgtcaactcgacaaccaacaggtgctgtaagaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29197869 |
cattgcaactattgatgctcgttttgattcaaaatccttcatcactcaagtgatctcctccaatgatgtcaactcgacaaccaacaggtgctgtaagaat |
29197770 |
T |
|
| Q |
101 |
gttgaatggttctatgttgaatggattcctgttatgtgccaatgtctagatattgtagaaacctgtgaatcaacttgcaattactgtacttgcaaacaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29197769 |
gttgaatggttctatgttgaatggattcctattatgtgccaatgtctagatattgtagaaacctgtgaatcaacttgcaaatactgtacttgcaaacaac |
29197670 |
T |
|
| Q |
201 |
ctaagcggtgtacttgcgatg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
29197669 |
ctaagcggtgtacttgcgatg |
29197649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 137 - 221
Target Start/End: Complemental strand, 29202289 - 29202205
Alignment:
| Q |
137 |
tgccaatgtctagatattgtagaaacctgtgaatcaacttgcaattactgtacttgcaaacaacctaagcggtgtacttgcgatg |
221 |
Q |
| |
|
||||||||| ||||||||| ||||||||| |||||||| ||||| | |||||||| ||||||||||| | ||||| |||||||| |
|
|
| T |
29202289 |
tgccaatgtgtagatattgcagaaacctgcgaatcaacctgcaaaaagtgtacttgtaaacaacctaaacagtgtagttgcgatg |
29202205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 12 - 57
Target Start/End: Complemental strand, 29153685 - 29153640
Alignment:
| Q |
12 |
ttgatgctcgttttgattcaaaatccttcatcactcaagtgatctc |
57 |
Q |
| |
|
||||||||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
29153685 |
ttgatgctcgtttcgattcaacatccttcataactcaagtgatctc |
29153640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University