View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16551_high_69 (Length: 206)
Name: NF16551_high_69
Description: NF16551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16551_high_69 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 11 - 175
Target Start/End: Complemental strand, 3808964 - 3808805
Alignment:
| Q |
11 |
tcgaagaatatattacaagtaagacactgacacaattcctattttatgaatatccatatcataaaataaaatatgttatgtcatgtcggtatgtttgaaa |
110 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3808964 |
tcgaagactatattacaagtaagacactgacacatttcctattttatgaatatccatatgataaaataaaatatgttatgtc-----ggtatgtttgaaa |
3808870 |
T |
 |
| Q |
111 |
ttttggaaaatcctagtaatattgaattgaaaggatcaagtactttgacaactagctaattggtg |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
3808869 |
ttttggaaaatcctagtaatattgaattgaaaggatcaggtactttggcaactagctaattggtg |
3808805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University