View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16551_high_70 (Length: 206)
Name: NF16551_high_70
Description: NF16551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16551_high_70 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 42442372 - 42442577
Alignment:
| Q |
1 |
ccccaccagaacaaatatgctttgaacttcttggagcccaagcaatagcattaacaccagcgcaatgtctctccaattctgcgaccggtgtagttggtga |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42442372 |
ccccaccggaacaaatatgctttgaacttcttggagcccaagcaatagcattaacaccagcgcgatgtctctccaattccgcgaccggtgtagttggtga |
42442471 |
T |
 |
| Q |
101 |
tctaatatccaaaatcacaactttattactatccatcaaaatagtggccatatacctcaaatccttcttgttccaagctaaacgaagcaaaggggtatca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42442472 |
tctaatatccaaaatcacaactttattactatccatcaaaatcgtggccatatacctcaaatccttcttgttccaagctaaacgaagcaaaggggtatca |
42442571 |
T |
 |
| Q |
201 |
ggttgc |
206 |
Q |
| |
|
|||||| |
|
|
| T |
42442572 |
ggttgc |
42442577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 42439020 - 42439098
Alignment:
| Q |
1 |
ccccaccagaacaaatatgctttgaacttcttggagcccaagcaatagcattaacaccagcgcaatgtctctccaattc |
79 |
Q |
| |
|
||||||| |||||||||||||| ||| ||||||||||||| |||| |||| ||| ||||| ||||||||||||||| |
|
|
| T |
42439020 |
ccccacccgaacaaatatgcttcaaacatcttggagcccaaacaatcacattgacatcagcgtgatgtctctccaattc |
42439098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University