View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16551_low_66 (Length: 240)
Name: NF16551_low_66
Description: NF16551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16551_low_66 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 48808219 - 48807995
Alignment:
| Q |
1 |
tgatgtagctagtgtcgaagaatccatagattgtacctttctgttagcaacaatcatgtaaaaagaagattgtaaaattactcataactctaaaatgcaa |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48808219 |
tgatgtagctagtggcgaagaatccatagattgtacctttctgttagcaacaatcatgtaaaaagaagattgtaaaattactcataactctaaaatgcaa |
48808120 |
T |
|
| Q |
101 |
ttagaacacgtactttg--nnnnnnnntaaaagaatgacgatgtgacgtctttgacaattgacagtggtccccctgaatgccactacacactatctaccc |
198 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48808119 |
ttagaacacgtactttgaaaaaaagaaaaaaagaatgacgatgtgacgtctttgacaattgacagtggtccccctgaatgccactacacactatctaccc |
48808020 |
T |
|
| Q |
199 |
cacatagttgccgacgtcttcggtg |
223 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
48808019 |
cacatagttgccgacgtcttcggtg |
48807995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University