View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16551_low_73 (Length: 212)
Name: NF16551_low_73
Description: NF16551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16551_low_73 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 7e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 99 - 194
Target Start/End: Complemental strand, 34688487 - 34688392
Alignment:
| Q |
99 |
attaaatgtatatgcagtggggatccgacagtatatgaaagattttggagacaaacaggtgacaagagcacgatcataataccaggatggcaatcc |
194 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34688487 |
attatatgtatatgcagtggggatccgacagtatatgaaagattttggagacaaacaggtgacaagagcacgatcataataccaggatggcaatcc |
34688392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 16 - 105
Target Start/End: Complemental strand, 34688616 - 34688527
Alignment:
| Q |
16 |
atgaactagtaaataaaaagcttgtttggtatggaacataataatgatctattttttaaattgtggtcaattgacttcaatcaattaaat |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34688616 |
atgaactagtaaataaaaagcttgtttggtatggaacataataatgatctattttttaaattgtggtcaattgacttgaatcaattaaat |
34688527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University